Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623997_s_at:

>probe:Drosophila_2:1623997_s_at:389:647; Interrogation_Position=101; Antisense; TCATGCAGCTGTTCGTCCGTGGACT
>probe:Drosophila_2:1623997_s_at:377:639; Interrogation_Position=113; Antisense; TCGTCCGTGGACTAGAGACCATCGA
>probe:Drosophila_2:1623997_s_at:711:261; Interrogation_Position=162; Antisense; CACCATTGCCGGAGTCAAGAACCAA
>probe:Drosophila_2:1623997_s_at:75:197; Interrogation_Position=185; Antisense; AACTGGCCCAGATCCATGGATTCAA
>probe:Drosophila_2:1623997_s_at:318:461; Interrogation_Position=203; Antisense; GATTCAACGCCGAGGAATTCAGCCT
>probe:Drosophila_2:1623997_s_at:438:245; Interrogation_Position=218; Antisense; AATTCAGCCTCGATTGCGAGGGCAT
>probe:Drosophila_2:1623997_s_at:558:433; Interrogation_Position=235; Antisense; GAGGGCATCACTCTGGCCAACGAGA
>probe:Drosophila_2:1623997_s_at:89:609; Interrogation_Position=275; Antisense; TGAGCTCCTTTGAGCTGGACCTCAA
>probe:Drosophila_2:1623997_s_at:215:413; Interrogation_Position=292; Antisense; GACCTCAACATTCCCATGCTGGGAG
>probe:Drosophila_2:1623997_s_at:347:493; Interrogation_Position=317; Antisense; GTAAGGTGCACGGTTCTCTGGCCCG
>probe:Drosophila_2:1623997_s_at:517:107; Interrogation_Position=395; Antisense; AGAAGAAGACCGGACGCGCCAAGCG
>probe:Drosophila_2:1623997_s_at:224:323; Interrogation_Position=410; Antisense; GCGCCAAGCGCAGGATCCAGTACAA
>probe:Drosophila_2:1623997_s_at:362:471; Interrogation_Position=441; Antisense; GTTCGTCAACTTTGTGCAGGGCTTC
>probe:Drosophila_2:1623997_s_at:311:515; Interrogation_Position=521; Antisense; GTGTCTACCTTTTACTCCAGATTGA

Paste this into a BLAST search page for me
TCATGCAGCTGTTCGTCCGTGGACTTCGTCCGTGGACTAGAGACCATCGACACCATTGCCGGAGTCAAGAACCAAAACTGGCCCAGATCCATGGATTCAAGATTCAACGCCGAGGAATTCAGCCTAATTCAGCCTCGATTGCGAGGGCATGAGGGCATCACTCTGGCCAACGAGATGAGCTCCTTTGAGCTGGACCTCAAGACCTCAACATTCCCATGCTGGGAGGTAAGGTGCACGGTTCTCTGGCCCGAGAAGAAGACCGGACGCGCCAAGCGGCGCCAAGCGCAGGATCCAGTACAAGTTCGTCAACTTTGTGCAGGGCTTCGTGTCTACCTTTTACTCCAGATTGA

Full Affymetrix probeset data:

Annotations for 1623997_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime