Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623998_at:

>probe:Drosophila_2:1623998_at:542:107; Interrogation_Position=1642; Antisense; AGAACACAGATCACTCGAAGAGCTC
>probe:Drosophila_2:1623998_at:483:375; Interrogation_Position=1658; Antisense; GAAGAGCTCCCTGAAGACTCAAGCC
>probe:Drosophila_2:1623998_at:209:405; Interrogation_Position=1673; Antisense; GACTCAAGCCAACGATGCGGCATTT
>probe:Drosophila_2:1623998_at:128:571; Interrogation_Position=1691; Antisense; GGCATTTGCCAGTTTCGAGAAGTCC
>probe:Drosophila_2:1623998_at:511:657; Interrogation_Position=1808; Antisense; TAAGGCGAACAATCAGTCAACCAAG
>probe:Drosophila_2:1623998_at:499:209; Interrogation_Position=1830; Antisense; AAGCAGAATGGCACGGCTCCAGCTC
>probe:Drosophila_2:1623998_at:727:91; Interrogation_Position=1883; Antisense; AGTTCCGGCCACAAATGGGTCTACG
>probe:Drosophila_2:1623998_at:320:205; Interrogation_Position=1948; Antisense; AAGCCCTGCTCGAACAGGCCATTAA
>probe:Drosophila_2:1623998_at:665:577; Interrogation_Position=1964; Antisense; GGCCATTAAAACCTATCCAACGACG
>probe:Drosophila_2:1623998_at:365:397; Interrogation_Position=1988; Antisense; GACACCCGATCGCTGGGATTGCATC
>probe:Drosophila_2:1623998_at:92:183; Interrogation_Position=2038; Antisense; AAAAGGACTGCTTACGTCGCGTCAA
>probe:Drosophila_2:1623998_at:18:707; Interrogation_Position=2049; Antisense; TTACGTCGCGTCAAAGAGCTGGTCG
>probe:Drosophila_2:1623998_at:590:117; Interrogation_Position=2065; Antisense; AGCTGGTCGAGCTGGTTAACTCCAA
>probe:Drosophila_2:1623998_at:603:537; Interrogation_Position=2108; Antisense; GGTCAAATGAGTGCGGCTCCTGCTC

Paste this into a BLAST search page for me
AGAACACAGATCACTCGAAGAGCTCGAAGAGCTCCCTGAAGACTCAAGCCGACTCAAGCCAACGATGCGGCATTTGGCATTTGCCAGTTTCGAGAAGTCCTAAGGCGAACAATCAGTCAACCAAGAAGCAGAATGGCACGGCTCCAGCTCAGTTCCGGCCACAAATGGGTCTACGAAGCCCTGCTCGAACAGGCCATTAAGGCCATTAAAACCTATCCAACGACGGACACCCGATCGCTGGGATTGCATCAAAAGGACTGCTTACGTCGCGTCAATTACGTCGCGTCAAAGAGCTGGTCGAGCTGGTCGAGCTGGTTAACTCCAAGGTCAAATGAGTGCGGCTCCTGCTC

Full Affymetrix probeset data:

Annotations for 1623998_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime