FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623999_at:

>probe:Drosophila_2:1623999_at:440:17; Interrogation_Position=111; Antisense; ATTTCGGGTGAAGACAATGGGATAT
>probe:Drosophila_2:1623999_at:286:543; Interrogation_Position=130; Antisense; GGATATAATCCCATTGAACTTCTTC
>probe:Drosophila_2:1623999_at:543:655; Interrogation_Position=135; Antisense; TAATCCCATTGAACTTCTTCATCAA
>probe:Drosophila_2:1623999_at:571:449; Interrogation_Position=19; Antisense; GATCCCAGTGACTACGACTCGGTTT
>probe:Drosophila_2:1623999_at:456:511; Interrogation_Position=26; Antisense; GTGACTACGACTCGGTTTACAGCGA
>probe:Drosophila_2:1623999_at:211:279; Interrogation_Position=30; Antisense; CTACGACTCGGTTTACAGCGAGGAA
>probe:Drosophila_2:1623999_at:600:477; Interrogation_Position=40; Antisense; GTTTACAGCGAGGAAGACTTCGTCG
>probe:Drosophila_2:1623999_at:177:439; Interrogation_Position=49; Antisense; GAGGAAGACTTCGTCGACACCGTGC
>probe:Drosophila_2:1623999_at:710:375; Interrogation_Position=52; Antisense; GAAGACTTCGTCGACACCGTGCGAG
>probe:Drosophila_2:1623999_at:474:401; Interrogation_Position=55; Antisense; GACTTCGTCGACACCGTGCGAGGAG
>probe:Drosophila_2:1623999_at:163:637; Interrogation_Position=62; Antisense; TCGACACCGTGCGAGGAGCTGCAAC
>probe:Drosophila_2:1623999_at:158:283; Interrogation_Position=86; Antisense; CTCCTCCGCTGATGGACTACGAAGA
>probe:Drosophila_2:1623999_at:350:633; Interrogation_Position=90; Antisense; TCCGCTGATGGACTACGAAGAATTT
>probe:Drosophila_2:1623999_at:98:585; Interrogation_Position=98; Antisense; TGGACTACGAAGAATTTCGGGTGAA

Paste this into a BLAST search page for me
ATTTCGGGTGAAGACAATGGGATATGGATATAATCCCATTGAACTTCTTCTAATCCCATTGAACTTCTTCATCAAGATCCCAGTGACTACGACTCGGTTTGTGACTACGACTCGGTTTACAGCGACTACGACTCGGTTTACAGCGAGGAAGTTTACAGCGAGGAAGACTTCGTCGGAGGAAGACTTCGTCGACACCGTGCGAAGACTTCGTCGACACCGTGCGAGGACTTCGTCGACACCGTGCGAGGAGTCGACACCGTGCGAGGAGCTGCAACCTCCTCCGCTGATGGACTACGAAGATCCGCTGATGGACTACGAAGAATTTTGGACTACGAAGAATTTCGGGTGAA

Full Affymetrix probeset data:

Annotations for 1623999_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720