FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624000_at:

>probe:Drosophila_2:1624000_at:419:561; Interrogation_Position=1044; Antisense; GGAAACACAATCACTATCGCCGGAA
>probe:Drosophila_2:1624000_at:451:45; Interrogation_Position=1059; Antisense; ATCGCCGGAAATCAGTACGCATCGT
>probe:Drosophila_2:1624000_at:486:357; Interrogation_Position=1136; Antisense; GCAAGGATAAACGTCGCCAGGGCTC
>probe:Drosophila_2:1624000_at:165:503; Interrogation_Position=1169; Antisense; GTCCCGCAATCGCTGGCGTAATGGA
>probe:Drosophila_2:1624000_at:403:521; Interrogation_Position=1221; Antisense; GTGGCAGATTCTCCCATATGCGGAA
>probe:Drosophila_2:1624000_at:293:15; Interrogation_Position=1267; Antisense; ATTTACGATACCATCGCCGATGATG
>probe:Drosophila_2:1624000_at:206:73; Interrogation_Position=747; Antisense; AGGAATGCAGCAGCTTGTCAGCCCG
>probe:Drosophila_2:1624000_at:700:725; Interrogation_Position=761; Antisense; TTGTCAGCCCGACGACAGCGGAGAA
>probe:Drosophila_2:1624000_at:614:533; Interrogation_Position=790; Antisense; GGTGACACCGGCACAAAGGCTCAGT
>probe:Drosophila_2:1624000_at:613:255; Interrogation_Position=803; Antisense; CAAAGGCTCAGTCCGGCCAGAGAAG
>probe:Drosophila_2:1624000_at:273:189; Interrogation_Position=891; Antisense; AACAGGAGCACCAACGTCTAATGAA
>probe:Drosophila_2:1624000_at:448:381; Interrogation_Position=936; Antisense; GAACCGAGTTGTCACTGCACCAGTT
>probe:Drosophila_2:1624000_at:492:589; Interrogation_Position=963; Antisense; TGGTCCTGTTCGTCCTGAAACTAAC
>probe:Drosophila_2:1624000_at:727:575; Interrogation_Position=995; Antisense; TGGGACCAGGTTCTGGCCCATTAAA

Paste this into a BLAST search page for me
GGAAACACAATCACTATCGCCGGAAATCGCCGGAAATCAGTACGCATCGTGCAAGGATAAACGTCGCCAGGGCTCGTCCCGCAATCGCTGGCGTAATGGAGTGGCAGATTCTCCCATATGCGGAAATTTACGATACCATCGCCGATGATGAGGAATGCAGCAGCTTGTCAGCCCGTTGTCAGCCCGACGACAGCGGAGAAGGTGACACCGGCACAAAGGCTCAGTCAAAGGCTCAGTCCGGCCAGAGAAGAACAGGAGCACCAACGTCTAATGAAGAACCGAGTTGTCACTGCACCAGTTTGGTCCTGTTCGTCCTGAAACTAACTGGGACCAGGTTCTGGCCCATTAAA

Full Affymetrix probeset data:

Annotations for 1624000_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720