Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624003_at:

>probe:Drosophila_2:1624003_at:688:127; Interrogation_Position=1364; Antisense; ACCAAATGCCGTTCTGGCTCTGAAA
>probe:Drosophila_2:1624003_at:674:653; Interrogation_Position=1415; Antisense; TAATCTTTTCGAGCTTTTCGACGCC
>probe:Drosophila_2:1624003_at:373:339; Interrogation_Position=1444; Antisense; GCTATCCGGGCTTCGTAAAGATGGC
>probe:Drosophila_2:1624003_at:73:219; Interrogation_Position=1473; Antisense; AAGTACATCGGTTTCGGACTCAGCG
>probe:Drosophila_2:1624003_at:313:575; Interrogation_Position=1535; Antisense; GGCGTTGCAGAAGTACATCCCGGAT
>probe:Drosophila_2:1624003_at:310:431; Interrogation_Position=1566; Antisense; GAGTACGATATCCAGCGTGGTCCCG
>probe:Drosophila_2:1624003_at:203:431; Interrogation_Position=1594; Antisense; GAGTACGTGCCCAAGCAATGGATCT
>probe:Drosophila_2:1624003_at:580:291; Interrogation_Position=1637; Antisense; CGATTTTGTTTTCGATCGCGGACAA
>probe:Drosophila_2:1624003_at:689:339; Interrogation_Position=1719; Antisense; GCTACTAGTAGCTTGGCCATTGCCA
>probe:Drosophila_2:1624003_at:329:367; Interrogation_Position=1766; Antisense; GAATGAGTTCTCTATCGGCAAGTGA
>probe:Drosophila_2:1624003_at:567:251; Interrogation_Position=1784; Antisense; CAAGTGATGCCTCTATCCCAAATAA
>probe:Drosophila_2:1624003_at:377:147; Interrogation_Position=1826; Antisense; ACTAAGTCCTATTTTCTGTTCTGCC
>probe:Drosophila_2:1624003_at:432:493; Interrogation_Position=1860; Antisense; GTAATGTCTGTACTGATTCGCCACT
>probe:Drosophila_2:1624003_at:287:313; Interrogation_Position=1879; Antisense; GCCACTATCGCATTTCTTTTCGAAA

Paste this into a BLAST search page for me
ACCAAATGCCGTTCTGGCTCTGAAATAATCTTTTCGAGCTTTTCGACGCCGCTATCCGGGCTTCGTAAAGATGGCAAGTACATCGGTTTCGGACTCAGCGGGCGTTGCAGAAGTACATCCCGGATGAGTACGATATCCAGCGTGGTCCCGGAGTACGTGCCCAAGCAATGGATCTCGATTTTGTTTTCGATCGCGGACAAGCTACTAGTAGCTTGGCCATTGCCAGAATGAGTTCTCTATCGGCAAGTGACAAGTGATGCCTCTATCCCAAATAAACTAAGTCCTATTTTCTGTTCTGCCGTAATGTCTGTACTGATTCGCCACTGCCACTATCGCATTTCTTTTCGAAA

Full Affymetrix probeset data:

Annotations for 1624003_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime