FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624006_at:

>probe:Drosophila_2:1624006_at:451:111; Interrogation_Position=2133; Antisense; AGCAAGGCAAGTCGCCCATGGAGCT
>probe:Drosophila_2:1624006_at:705:97; Interrogation_Position=2193; Antisense; AGATGCAACAGGATAACTCGCAGCA
>probe:Drosophila_2:1624006_at:550:351; Interrogation_Position=2215; Antisense; GCAGCAACACTACAACCAGTTCCAA
>probe:Drosophila_2:1624006_at:480:305; Interrogation_Position=2230; Antisense; CCAGTTCCAACTCAATATGCAGATG
>probe:Drosophila_2:1624006_at:563:569; Interrogation_Position=2297; Antisense; GGCATGCCCATGCAACAGAATCAAA
>probe:Drosophila_2:1624006_at:606:111; Interrogation_Position=2340; Antisense; AGCAACAGCGAATGCCACTGGGCGT
>probe:Drosophila_2:1624006_at:135:235; Interrogation_Position=2402; Antisense; AATCCAAACCTCCAGCAGCAGTTGC
>probe:Drosophila_2:1624006_at:411:115; Interrogation_Position=2418; Antisense; AGCAGTTGCAACAAGTGGCGCCAAA
>probe:Drosophila_2:1624006_at:22:593; Interrogation_Position=2490; Antisense; TGGTGCGTCCCATGATGAGCAACAA
>probe:Drosophila_2:1624006_at:303:73; Interrogation_Position=2557; Antisense; AGGCAATCAGTTCCGGCCGCAAATG
>probe:Drosophila_2:1624006_at:617:531; Interrogation_Position=2581; Antisense; GGGTGGCCAGAATCCCAATCAAATG
>probe:Drosophila_2:1624006_at:47:331; Interrogation_Position=2613; Antisense; GCGGTCCAATGGTCGGCAATCGCAA
>probe:Drosophila_2:1624006_at:256:565; Interrogation_Position=2627; Antisense; GGCAATCGCAACTTTGACGACGGAA
>probe:Drosophila_2:1624006_at:298:277; Interrogation_Position=2653; Antisense; CTATGAGTTCATGTAGGCTACTTAA

Paste this into a BLAST search page for me
AGCAAGGCAAGTCGCCCATGGAGCTAGATGCAACAGGATAACTCGCAGCAGCAGCAACACTACAACCAGTTCCAACCAGTTCCAACTCAATATGCAGATGGGCATGCCCATGCAACAGAATCAAAAGCAACAGCGAATGCCACTGGGCGTAATCCAAACCTCCAGCAGCAGTTGCAGCAGTTGCAACAAGTGGCGCCAAATGGTGCGTCCCATGATGAGCAACAAAGGCAATCAGTTCCGGCCGCAAATGGGGTGGCCAGAATCCCAATCAAATGGCGGTCCAATGGTCGGCAATCGCAAGGCAATCGCAACTTTGACGACGGAACTATGAGTTCATGTAGGCTACTTAA

Full Affymetrix probeset data:

Annotations for 1624006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720