FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624007_at:

>probe:Drosophila_2:1624007_at:155:593; Interrogation_Position=1024; Antisense; TGGGTGTTCAGGATGCGAACCCTTC
>probe:Drosophila_2:1624007_at:369:717; Interrogation_Position=1046; Antisense; TTCGCAATCTGCTGTGCCACCAAAA
>probe:Drosophila_2:1624007_at:164:593; Interrogation_Position=1088; Antisense; TGTGGTGAACATATCTCCGTCGGGA
>probe:Drosophila_2:1624007_at:594:429; Interrogation_Position=1111; Antisense; GAGTTATTCGTCTGTGCGATCGCTT
>probe:Drosophila_2:1624007_at:193:677; Interrogation_Position=1136; Antisense; TAGTCCACCTGCTAAACAATGCGAT
>probe:Drosophila_2:1624007_at:5:357; Interrogation_Position=1195; Antisense; GACCCCTTCAAAACTGGACAATCCG
>probe:Drosophila_2:1624007_at:112:395; Interrogation_Position=1222; Antisense; GAAATCCGCCGGTACCATTGAACAA
>probe:Drosophila_2:1624007_at:634:449; Interrogation_Position=1268; Antisense; GATCGTGCAGCGCTATAGCATCGAC
>probe:Drosophila_2:1624007_at:572:253; Interrogation_Position=1293; Antisense; CAACTGCTGGTTTTGGAGCCTCAAC
>probe:Drosophila_2:1624007_at:425:673; Interrogation_Position=1357; Antisense; TAGGCTTGGGATTTCTGTACGATTC
>probe:Drosophila_2:1624007_at:273:489; Interrogation_Position=1373; Antisense; GTACGATTCATTTGAGGGCTCTCCA
>probe:Drosophila_2:1624007_at:91:435; Interrogation_Position=1386; Antisense; GAGGGCTCTCCATAAATGTATTCGA
>probe:Drosophila_2:1624007_at:365:231; Interrogation_Position=870; Antisense; AATGAACCTGCTAAACCTATGCCTC
>probe:Drosophila_2:1624007_at:670:555; Interrogation_Position=965; Antisense; GGACGAGCGATGTCGTGCCAAACAT

Paste this into a BLAST search page for me
TGGGTGTTCAGGATGCGAACCCTTCTTCGCAATCTGCTGTGCCACCAAAATGTGGTGAACATATCTCCGTCGGGAGAGTTATTCGTCTGTGCGATCGCTTTAGTCCACCTGCTAAACAATGCGATGACCCCTTCAAAACTGGACAATCCGGAAATCCGCCGGTACCATTGAACAAGATCGTGCAGCGCTATAGCATCGACCAACTGCTGGTTTTGGAGCCTCAACTAGGCTTGGGATTTCTGTACGATTCGTACGATTCATTTGAGGGCTCTCCAGAGGGCTCTCCATAAATGTATTCGAAATGAACCTGCTAAACCTATGCCTCGGACGAGCGATGTCGTGCCAAACAT

Full Affymetrix probeset data:

Annotations for 1624007_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720