FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624008_at:

>probe:Drosophila_2:1624008_at:591:273; Interrogation_Position=1934; Antisense; CATTCAGGCGTGGTACGCGCAGTTG
>probe:Drosophila_2:1624008_at:239:77; Interrogation_Position=1963; Antisense; AGGAGGAGCATGCACACCTGCGCCA
>probe:Drosophila_2:1624008_at:205:207; Interrogation_Position=1998; Antisense; AAGCTCGTGGCTTGGTTGGATCAAT
>probe:Drosophila_2:1624008_at:53:403; Interrogation_Position=2055; Antisense; GACTAAGCAAAGTCGTAGCCCTTAT
>probe:Drosophila_2:1624008_at:142:675; Interrogation_Position=2070; Antisense; TAGCCCTTATTCTTTATTCCCATTT
>probe:Drosophila_2:1624008_at:630:217; Interrogation_Position=2099; Antisense; AAGTCATTTCCTTGCTCATTCTAAG
>probe:Drosophila_2:1624008_at:706:11; Interrogation_Position=2156; Antisense; ATTCACATCGACATATTTTGGCCAA
>probe:Drosophila_2:1624008_at:425:579; Interrogation_Position=2175; Antisense; GGCCAAATTTCGACTTTGCGTCCGA
>probe:Drosophila_2:1624008_at:634:693; Interrogation_Position=2189; Antisense; TTTGCGTCCGAAATCTGCTAGTTTT
>probe:Drosophila_2:1624008_at:10:165; Interrogation_Position=2199; Antisense; AAATCTGCTAGTTTTTTGGCCACAA
>probe:Drosophila_2:1624008_at:180:691; Interrogation_Position=2213; Antisense; TTTGGCCACAACGTCGGAAATAATT
>probe:Drosophila_2:1624008_at:405:513; Interrogation_Position=2253; Antisense; GTGATGCATCGTTGAGCTTGTAATT
>probe:Drosophila_2:1624008_at:198:237; Interrogation_Position=2286; Antisense; AATCGACTGACATTCAAGCCTGAAC
>probe:Drosophila_2:1624008_at:370:701; Interrogation_Position=2313; Antisense; TTTTATTTTTTCACATTTCTCGCAA

Paste this into a BLAST search page for me
CATTCAGGCGTGGTACGCGCAGTTGAGGAGGAGCATGCACACCTGCGCCAAAGCTCGTGGCTTGGTTGGATCAATGACTAAGCAAAGTCGTAGCCCTTATTAGCCCTTATTCTTTATTCCCATTTAAGTCATTTCCTTGCTCATTCTAAGATTCACATCGACATATTTTGGCCAAGGCCAAATTTCGACTTTGCGTCCGATTTGCGTCCGAAATCTGCTAGTTTTAAATCTGCTAGTTTTTTGGCCACAATTTGGCCACAACGTCGGAAATAATTGTGATGCATCGTTGAGCTTGTAATTAATCGACTGACATTCAAGCCTGAACTTTTATTTTTTCACATTTCTCGCAA

Full Affymetrix probeset data:

Annotations for 1624008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720