FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624011_at:

>probe:Drosophila_2:1624011_at:158:541; Interrogation_Position=1038; Antisense; GGTTCTCTTCCCAAAGAGCCTAGAG
>probe:Drosophila_2:1624011_at:691:145; Interrogation_Position=1111; Antisense; ACTCTGGTCCAGAACATGGTGCGCA
>probe:Drosophila_2:1624011_at:12:519; Interrogation_Position=1169; Antisense; GTGGGCATAGCTTCGACTCCGGCAG
>probe:Drosophila_2:1624011_at:193:567; Interrogation_Position=1189; Antisense; GGCAGCTACCGCACCTTGGAAGGAG
>probe:Drosophila_2:1624011_at:714:367; Interrogation_Position=666; Antisense; GAATGAGCCCAAGGAGTACCGACCC
>probe:Drosophila_2:1624011_at:470:157; Interrogation_Position=758; Antisense; ACAACTACATACACAAGCCGTCGGT
>probe:Drosophila_2:1624011_at:314:361; Interrogation_Position=789; Antisense; GCAATCGCTGCACACTAGTTTCTCC
>probe:Drosophila_2:1624011_at:117:171; Interrogation_Position=819; Antisense; AAAGCCCAGGATTAACATCCCCGAG
>probe:Drosophila_2:1624011_at:417:707; Interrogation_Position=830; Antisense; TTAACATCCCCGAGAGCATTTCCAA
>probe:Drosophila_2:1624011_at:289:19; Interrogation_Position=847; Antisense; ATTTCCAACCACATTCACCAGAAGA
>probe:Drosophila_2:1624011_at:476:209; Interrogation_Position=868; Antisense; AAGAAGGTGGTTCACACCACGCCTG
>probe:Drosophila_2:1624011_at:68:261; Interrogation_Position=885; Antisense; CACGCCTGGCTTGAAGCACTACAAG
>probe:Drosophila_2:1624011_at:273:147; Interrogation_Position=902; Antisense; ACTACAAGTACAAGGGCGTGTCCAA
>probe:Drosophila_2:1624011_at:414:263; Interrogation_Position=988; Antisense; CAGCATCCCAAGCAGAAGCCACGTG

Paste this into a BLAST search page for me
GGTTCTCTTCCCAAAGAGCCTAGAGACTCTGGTCCAGAACATGGTGCGCAGTGGGCATAGCTTCGACTCCGGCAGGGCAGCTACCGCACCTTGGAAGGAGGAATGAGCCCAAGGAGTACCGACCCACAACTACATACACAAGCCGTCGGTGCAATCGCTGCACACTAGTTTCTCCAAAGCCCAGGATTAACATCCCCGAGTTAACATCCCCGAGAGCATTTCCAAATTTCCAACCACATTCACCAGAAGAAAGAAGGTGGTTCACACCACGCCTGCACGCCTGGCTTGAAGCACTACAAGACTACAAGTACAAGGGCGTGTCCAACAGCATCCCAAGCAGAAGCCACGTG

Full Affymetrix probeset data:

Annotations for 1624011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720