FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624012_at:

>probe:Drosophila_2:1624012_at:381:363; Interrogation_Position=353; Antisense; GAATTGGCTGGATCATTCCCGACTG
>probe:Drosophila_2:1624012_at:364:143; Interrogation_Position=374; Antisense; ACTGGTTGCCTTCTTTCACTTAAGT
>probe:Drosophila_2:1624012_at:566:657; Interrogation_Position=394; Antisense; TAAGTTCTATAACCGCCGATGACAT
>probe:Drosophila_2:1624012_at:144:507; Interrogation_Position=426; Antisense; GTGCGCGTTCAGCTTCACAAGCAGA
>probe:Drosophila_2:1624012_at:278:87; Interrogation_Position=463; Antisense; AGTCCTACGGCAGCAAGATCATCGA
>probe:Drosophila_2:1624012_at:110:457; Interrogation_Position=508; Antisense; GATACGAAGCGATTGTGCCCCTGTT
>probe:Drosophila_2:1624012_at:336:181; Interrogation_Position=571; Antisense; AAAAGACTGCCGCACTGCTACGAAT
>probe:Drosophila_2:1624012_at:477:365; Interrogation_Position=592; Antisense; GAATCGTTCGCAGGGTGCCGCAAAT
>probe:Drosophila_2:1624012_at:283:169; Interrogation_Position=613; Antisense; AAATGGTCCTGCTGGGAGGCATCGT
>probe:Drosophila_2:1624012_at:562:677; Interrogation_Position=656; Antisense; TAGGAACCAGCTTGTGGCCTACGCT
>probe:Drosophila_2:1624012_at:575:189; Interrogation_Position=712; Antisense; AACTTGTCCAGACCCTTAGTCAAGC
>probe:Drosophila_2:1624012_at:136:581; Interrogation_Position=740; Antisense; TGGCCACCTTATTCAGCAACTGCAG
>probe:Drosophila_2:1624012_at:338:617; Interrogation_Position=760; Antisense; TGCAGGCCCATCAGAACAGTTTTGT
>probe:Drosophila_2:1624012_at:105:511; Interrogation_Position=783; Antisense; GTGCAAGTTCTTGATGTCCATGCTA

Paste this into a BLAST search page for me
GAATTGGCTGGATCATTCCCGACTGACTGGTTGCCTTCTTTCACTTAAGTTAAGTTCTATAACCGCCGATGACATGTGCGCGTTCAGCTTCACAAGCAGAAGTCCTACGGCAGCAAGATCATCGAGATACGAAGCGATTGTGCCCCTGTTAAAAGACTGCCGCACTGCTACGAATGAATCGTTCGCAGGGTGCCGCAAATAAATGGTCCTGCTGGGAGGCATCGTTAGGAACCAGCTTGTGGCCTACGCTAACTTGTCCAGACCCTTAGTCAAGCTGGCCACCTTATTCAGCAACTGCAGTGCAGGCCCATCAGAACAGTTTTGTGTGCAAGTTCTTGATGTCCATGCTA

Full Affymetrix probeset data:

Annotations for 1624012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720