FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624013_at:

>probe:Drosophila_2:1624013_at:317:53; Interrogation_Position=107; Antisense; ATGAAAGGGAAAGCGTCCGAACAGA
>probe:Drosophila_2:1624013_at:397:303; Interrogation_Position=123; Antisense; CCGAACAGACGATGATGGAGACAAT
>probe:Drosophila_2:1624013_at:657:423; Interrogation_Position=140; Antisense; GAGACAATTCCTCCACAACTTCGTT
>probe:Drosophila_2:1624013_at:614:159; Interrogation_Position=154; Antisense; ACAACTTCGTTGACCTCTATGGAGG
>probe:Drosophila_2:1624013_at:548:681; Interrogation_Position=171; Antisense; TATGGAGGCCCAGTTTTCTCAGGCT
>probe:Drosophila_2:1624013_at:47:435; Interrogation_Position=19; Antisense; GAGGGCAGCGCCTCAAGCGACACCG
>probe:Drosophila_2:1624013_at:140:261; Interrogation_Position=198; Antisense; CAGCACCTCCAGTTCTTTTCTTTTT
>probe:Drosophila_2:1624013_at:412:713; Interrogation_Position=210; Antisense; TTCTTTTCTTTTTCACCAACTGGAG
>probe:Drosophila_2:1624013_at:229:159; Interrogation_Position=239; Antisense; ACAACAACAGCCAGCATACGTCCAA
>probe:Drosophila_2:1624013_at:52:267; Interrogation_Position=257; Antisense; CGTCCAACCAAAATCACAAAGCCTT
>probe:Drosophila_2:1624013_at:244:205; Interrogation_Position=275; Antisense; AAGCCTTGAATGGACTAATTCCGGA
>probe:Drosophila_2:1624013_at:605:723; Interrogation_Position=303; Antisense; TTGTAATACTGAGTCAACAGCATCC
>probe:Drosophila_2:1624013_at:61:525; Interrogation_Position=44; Antisense; GGGCTAGCTACGACTCCGATGAAGA
>probe:Drosophila_2:1624013_at:663:99; Interrogation_Position=66; Antisense; AGAGGAGACCTCGTCAGGCGACAAT

Paste this into a BLAST search page for me
ATGAAAGGGAAAGCGTCCGAACAGACCGAACAGACGATGATGGAGACAATGAGACAATTCCTCCACAACTTCGTTACAACTTCGTTGACCTCTATGGAGGTATGGAGGCCCAGTTTTCTCAGGCTGAGGGCAGCGCCTCAAGCGACACCGCAGCACCTCCAGTTCTTTTCTTTTTTTCTTTTCTTTTTCACCAACTGGAGACAACAACAGCCAGCATACGTCCAACGTCCAACCAAAATCACAAAGCCTTAAGCCTTGAATGGACTAATTCCGGATTGTAATACTGAGTCAACAGCATCCGGGCTAGCTACGACTCCGATGAAGAAGAGGAGACCTCGTCAGGCGACAAT

Full Affymetrix probeset data:

Annotations for 1624013_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720