FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624014_at:

>probe:Drosophila_2:1624014_at:424:543; Interrogation_Position=220; Antisense; GGATATGCAGACGTTCCCGGTTCCA
>probe:Drosophila_2:1624014_at:700:539; Interrogation_Position=238; Antisense; GGTTCCACAACAAAGACTCCTTCAC
>probe:Drosophila_2:1624014_at:660:233; Interrogation_Position=263; Antisense; AATCCTCAGCCGTCAGCGAAACTGG
>probe:Drosophila_2:1624014_at:13:563; Interrogation_Position=351; Antisense; GGAACTGCTCCAGGATTCCGATGCC
>probe:Drosophila_2:1624014_at:502:293; Interrogation_Position=369; Antisense; CGATGCCCTGCGAAGACGTCGAGGA
>probe:Drosophila_2:1624014_at:299:553; Interrogation_Position=391; Antisense; GGAGCAGATGAATCCTCCTCCAGTT
>probe:Drosophila_2:1624014_at:302:283; Interrogation_Position=408; Antisense; CTCCAGTTCTGGAAGCGCAAACGTT
>probe:Drosophila_2:1624014_at:171:203; Interrogation_Position=457; Antisense; AACCAGGCTGCCAAGTATTATACGA
>probe:Drosophila_2:1624014_at:163:423; Interrogation_Position=490; Antisense; GAGAAGATCACCGAGCACATGCTCT
>probe:Drosophila_2:1624014_at:211:339; Interrogation_Position=510; Antisense; GCTCTCGCTGACTCGGAACTTAAAG
>probe:Drosophila_2:1624014_at:357:423; Interrogation_Position=544; Antisense; GAGACCGCCAACAGGATTATCCGAA
>probe:Drosophila_2:1624014_at:326:575; Interrogation_Position=603; Antisense; GGCGGATCGCAATATCAATTCGCTA
>probe:Drosophila_2:1624014_at:170:161; Interrogation_Position=671; Antisense; ACAAGTGCTGGCTGTGGCTGATGAT
>probe:Drosophila_2:1624014_at:74:59; Interrogation_Position=691; Antisense; ATGATTGCCTTCGTAATTGCCACTT

Paste this into a BLAST search page for me
GGATATGCAGACGTTCCCGGTTCCAGGTTCCACAACAAAGACTCCTTCACAATCCTCAGCCGTCAGCGAAACTGGGGAACTGCTCCAGGATTCCGATGCCCGATGCCCTGCGAAGACGTCGAGGAGGAGCAGATGAATCCTCCTCCAGTTCTCCAGTTCTGGAAGCGCAAACGTTAACCAGGCTGCCAAGTATTATACGAGAGAAGATCACCGAGCACATGCTCTGCTCTCGCTGACTCGGAACTTAAAGGAGACCGCCAACAGGATTATCCGAAGGCGGATCGCAATATCAATTCGCTAACAAGTGCTGGCTGTGGCTGATGATATGATTGCCTTCGTAATTGCCACTT

Full Affymetrix probeset data:

Annotations for 1624014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720