Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624015_at:

>probe:Drosophila_2:1624015_at:547:111; Interrogation_Position=161; Antisense; AGCACGCCGTGAATGTAGTCCATAT
>probe:Drosophila_2:1624015_at:475:29; Interrogation_Position=190; Antisense; ATAAAGCACCAATCGCTCAACAAGG
>probe:Drosophila_2:1624015_at:444:77; Interrogation_Position=224; Antisense; AGGTCAAAAACTCTAGCGCCACCAT
>probe:Drosophila_2:1624015_at:5:379; Interrogation_Position=297; Antisense; GAAGCGCATCAATGTCAAGAATCTA
>probe:Drosophila_2:1624015_at:273:605; Interrogation_Position=387; Antisense; TGATCAAGCGAATGGCACCGCCTAT
>probe:Drosophila_2:1624015_at:428:67; Interrogation_Position=398; Antisense; ATGGCACCGCCTATGATGAGGACCT
>probe:Drosophila_2:1624015_at:268:703; Interrogation_Position=422; Antisense; TTATTATGGAAGACTCCGGCAGCGA
>probe:Drosophila_2:1624015_at:691:225; Interrogation_Position=475; Antisense; AAGGCCCTGATAAAGAACCCCATGC
>probe:Drosophila_2:1624015_at:542:325; Interrogation_Position=530; Antisense; GCGACTCGGTGATGCCGATCATAAT
>probe:Drosophila_2:1624015_at:205:293; Interrogation_Position=545; Antisense; CGATCATAATGGACCGCATTGGCAT
>probe:Drosophila_2:1624015_at:388:191; Interrogation_Position=595; Antisense; AACTTGTGCTACATCCAGCCAGATC
>probe:Drosophila_2:1624015_at:622:535; Interrogation_Position=624; Antisense; GGTCCAGGACGCCAATGTCCAGCAA
>probe:Drosophila_2:1624015_at:649:263; Interrogation_Position=658; Antisense; CAGAGCATGTCTAACGCGATCGTGG
>probe:Drosophila_2:1624015_at:52:451; Interrogation_Position=675; Antisense; GATCGTGGATGTAACTGCCTCGGAG

Paste this into a BLAST search page for me
AGCACGCCGTGAATGTAGTCCATATATAAAGCACCAATCGCTCAACAAGGAGGTCAAAAACTCTAGCGCCACCATGAAGCGCATCAATGTCAAGAATCTATGATCAAGCGAATGGCACCGCCTATATGGCACCGCCTATGATGAGGACCTTTATTATGGAAGACTCCGGCAGCGAAAGGCCCTGATAAAGAACCCCATGCGCGACTCGGTGATGCCGATCATAATCGATCATAATGGACCGCATTGGCATAACTTGTGCTACATCCAGCCAGATCGGTCCAGGACGCCAATGTCCAGCAACAGAGCATGTCTAACGCGATCGTGGGATCGTGGATGTAACTGCCTCGGAG

Full Affymetrix probeset data:

Annotations for 1624015_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime