FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624016_at:

>probe:Drosophila_2:1624016_at:569:643; Interrogation_Position=1015; Antisense; TCTCGTCGAAAAGTGCAGGATGCTG
>probe:Drosophila_2:1624016_at:168:115; Interrogation_Position=1048; Antisense; AGCATTTACATGATATCCAACGAAA
>probe:Drosophila_2:1624016_at:191:171; Interrogation_Position=1100; Antisense; AAAGGGCCAAGGACAAGGACTATGC
>probe:Drosophila_2:1624016_at:46:357; Interrogation_Position=1181; Antisense; GCAAACGCAAGGATACTGGCTACTC
>probe:Drosophila_2:1624016_at:489:629; Interrogation_Position=1204; Antisense; TCCACGGCCAGCTCGCAGAATCTGT
>probe:Drosophila_2:1624016_at:179:351; Interrogation_Position=1218; Antisense; GCAGAATCTGTACTCCACGAAGGCG
>probe:Drosophila_2:1624016_at:339:83; Interrogation_Position=1243; Antisense; AGTGGCACGGACAAGGACACTCGCC
>probe:Drosophila_2:1624016_at:504:373; Interrogation_Position=1287; Antisense; GAAGTCCAAGCGCACCTGCAGCAGT
>probe:Drosophila_2:1624016_at:495:91; Interrogation_Position=1309; Antisense; AGTTCACCCAGTGACTGCGACTTGG
>probe:Drosophila_2:1624016_at:325:85; Interrogation_Position=1318; Antisense; AGTGACTGCGACTTGGCCAAAAAGC
>probe:Drosophila_2:1624016_at:22:237; Interrogation_Position=1379; Antisense; AATCCCGCAAAATTGAGGCAGTCGT
>probe:Drosophila_2:1624016_at:533:617; Interrogation_Position=1457; Antisense; TGCCCAGCTACGAGGTCATCGACGA
>probe:Drosophila_2:1624016_at:319:217; Interrogation_Position=1512; Antisense; AAGTAGTAGCGACACCAGTTCCGGG
>probe:Drosophila_2:1624016_at:310:495; Interrogation_Position=999; Antisense; GTCACGTCAGTTTCAATCTCGTCGA

Paste this into a BLAST search page for me
TCTCGTCGAAAAGTGCAGGATGCTGAGCATTTACATGATATCCAACGAAAAAAGGGCCAAGGACAAGGACTATGCGCAAACGCAAGGATACTGGCTACTCTCCACGGCCAGCTCGCAGAATCTGTGCAGAATCTGTACTCCACGAAGGCGAGTGGCACGGACAAGGACACTCGCCGAAGTCCAAGCGCACCTGCAGCAGTAGTTCACCCAGTGACTGCGACTTGGAGTGACTGCGACTTGGCCAAAAAGCAATCCCGCAAAATTGAGGCAGTCGTTGCCCAGCTACGAGGTCATCGACGAAAGTAGTAGCGACACCAGTTCCGGGGTCACGTCAGTTTCAATCTCGTCGA

Full Affymetrix probeset data:

Annotations for 1624016_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720