Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624019_s_at:

>probe:Drosophila_2:1624019_s_at:93:137; Interrogation_Position=112; Antisense; ACGAGCTGGCTATTGGCCTGAACAA
>probe:Drosophila_2:1624019_s_at:640:221; Interrogation_Position=135; Antisense; AAGGGCCACAAGACCTCGAAGATCA
>probe:Drosophila_2:1624019_s_at:176:451; Interrogation_Position=205; Antisense; GATCGCGCTTGAAGAACATCCAAAC
>probe:Drosophila_2:1624019_s_at:354:135; Interrogation_Position=253; Antisense; ACTTGGTCCGCGAGGTCGTTGGCCA
>probe:Drosophila_2:1624019_s_at:117:467; Interrogation_Position=270; Antisense; GTTGGCCACGCTCCCTATGAGAAGC
>probe:Drosophila_2:1624019_s_at:723:213; Interrogation_Position=327; Antisense; AAGAGGGCCCTGAAGTTCCTCAAGC
>probe:Drosophila_2:1624019_s_at:317:379; Interrogation_Position=383; Antisense; GAAGCGTGAGGAGTTGTCCAACATC
>probe:Drosophila_2:1624019_s_at:266:249; Interrogation_Position=429; Antisense; CAGACCCACGCCAAGTAAACGGACG
>probe:Drosophila_2:1624019_s_at:270:565; Interrogation_Position=453; Antisense; GGAATCTGATTCGACATCTCGGCAT
>probe:Drosophila_2:1624019_s_at:627:37; Interrogation_Position=468; Antisense; ATCTCGGCATCGGAAGGCAACCTGG
>probe:Drosophila_2:1624019_s_at:268:225; Interrogation_Position=481; Antisense; AAGGCAACCTGGAGCGCCGTGTTAT
>probe:Drosophila_2:1624019_s_at:93:515; Interrogation_Position=499; Antisense; GTGTTATGTTCTCATTTCTTTCCGA
>probe:Drosophila_2:1624019_s_at:594:713; Interrogation_Position=514; Antisense; TTCTTTCCGATGACGTTACTTGAGA
>probe:Drosophila_2:1624019_s_at:669:67; Interrogation_Position=99; Antisense; ATGGCAGTGCGCTACGAGCTGGCTA

Paste this into a BLAST search page for me
ACGAGCTGGCTATTGGCCTGAACAAAAGGGCCACAAGACCTCGAAGATCAGATCGCGCTTGAAGAACATCCAAACACTTGGTCCGCGAGGTCGTTGGCCAGTTGGCCACGCTCCCTATGAGAAGCAAGAGGGCCCTGAAGTTCCTCAAGCGAAGCGTGAGGAGTTGTCCAACATCCAGACCCACGCCAAGTAAACGGACGGGAATCTGATTCGACATCTCGGCATATCTCGGCATCGGAAGGCAACCTGGAAGGCAACCTGGAGCGCCGTGTTATGTGTTATGTTCTCATTTCTTTCCGATTCTTTCCGATGACGTTACTTGAGAATGGCAGTGCGCTACGAGCTGGCTA

Full Affymetrix probeset data:

Annotations for 1624019_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime