FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624020_at:

>probe:Drosophila_2:1624020_at:621:55; Interrogation_Position=1508; Antisense; ATGAAATGCGCTGTCGATCTCGCTG
>probe:Drosophila_2:1624020_at:463:381; Interrogation_Position=1542; Antisense; GAACGGACGCCTTAAGAGTGTGACA
>probe:Drosophila_2:1624020_at:156:563; Interrogation_Position=1648; Antisense; GGAAGAAAGCTCTCCAGGACGCACA
>probe:Drosophila_2:1624020_at:176:93; Interrogation_Position=1727; Antisense; AGTTGACTAGCGATGCGGCCACATT
>probe:Drosophila_2:1624020_at:139:333; Interrogation_Position=1741; Antisense; GCGGCCACATTGCAGTTGACAGATC
>probe:Drosophila_2:1624020_at:103:211; Interrogation_Position=1766; Antisense; AAGAACTGATGCACGCCTCCATGAT
>probe:Drosophila_2:1624020_at:283:339; Interrogation_Position=1791; Antisense; GCTCATGCACGAATAGATTGGCTAT
>probe:Drosophila_2:1624020_at:282:3; Interrogation_Position=1807; Antisense; ATTGGCTATCCAACTGGTCTTGGCA
>probe:Drosophila_2:1624020_at:101:557; Interrogation_Position=1883; Antisense; GGACTATGTACACTTATTTTCGATA
>probe:Drosophila_2:1624020_at:259:459; Interrogation_Position=1904; Antisense; GATATTTTCATCCTAGTTACCCGAA
>probe:Drosophila_2:1624020_at:405:365; Interrogation_Position=1985; Antisense; GAATATAGCTGTAAGACCCCTGAGT
>probe:Drosophila_2:1624020_at:119:103; Interrogation_Position=1998; Antisense; AGACCCCTGAGTTCGATTAACCAAT
>probe:Drosophila_2:1624020_at:253:723; Interrogation_Position=2050; Antisense; TTGCAAATCCAATTGTTCCATTCCC
>probe:Drosophila_2:1624020_at:250:721; Interrogation_Position=2065; Antisense; TTCCATTCCCTTGACGGCTATGTGA

Paste this into a BLAST search page for me
ATGAAATGCGCTGTCGATCTCGCTGGAACGGACGCCTTAAGAGTGTGACAGGAAGAAAGCTCTCCAGGACGCACAAGTTGACTAGCGATGCGGCCACATTGCGGCCACATTGCAGTTGACAGATCAAGAACTGATGCACGCCTCCATGATGCTCATGCACGAATAGATTGGCTATATTGGCTATCCAACTGGTCTTGGCAGGACTATGTACACTTATTTTCGATAGATATTTTCATCCTAGTTACCCGAAGAATATAGCTGTAAGACCCCTGAGTAGACCCCTGAGTTCGATTAACCAATTTGCAAATCCAATTGTTCCATTCCCTTCCATTCCCTTGACGGCTATGTGA

Full Affymetrix probeset data:

Annotations for 1624020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720