FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624022_at:

>probe:Drosophila_2:1624022_at:617:5; Interrogation_Position=1006; Antisense; ATTGTTACCTTAATCTGTGCGGAGA
>probe:Drosophila_2:1624022_at:301:721; Interrogation_Position=1031; Antisense; TTGCCTGGCCAGTCAGCTAATCGAA
>probe:Drosophila_2:1624022_at:45:415; Interrogation_Position=1092; Antisense; GACCAAGAGTCATGACGCTCCTAGA
>probe:Drosophila_2:1624022_at:156:279; Interrogation_Position=1112; Antisense; CTAGAGTCCCATTTACTTGAGTACT
>probe:Drosophila_2:1624022_at:625:99; Interrogation_Position=1240; Antisense; AGAGGCCCTCTTAATTGCGCAATTG
>probe:Drosophila_2:1624022_at:696:5; Interrogation_Position=1285; Antisense; ATTGAATACGCTGGCGACGCTTTGC
>probe:Drosophila_2:1624022_at:639:627; Interrogation_Position=1329; Antisense; TGCCATGTTTCTTTGTCCAACGTAT
>probe:Drosophila_2:1624022_at:377:437; Interrogation_Position=1385; Antisense; GAGGACCAGCAATCCATGCAGATCA
>probe:Drosophila_2:1624022_at:443:453; Interrogation_Position=1405; Antisense; GATCATCGGCATTACTTTTGACATT
>probe:Drosophila_2:1624022_at:321:13; Interrogation_Position=1427; Antisense; ATTAGCTTTACGCATGTCCACGAAA
>probe:Drosophila_2:1624022_at:356:561; Interrogation_Position=860; Antisense; GGAACTATGCCTTAAGCTTCTATCA
>probe:Drosophila_2:1624022_at:290:343; Interrogation_Position=875; Antisense; GCTTCTATCAGCCATTCAGGACGAG
>probe:Drosophila_2:1624022_at:356:439; Interrogation_Position=963; Antisense; GAGGCATCTGTGACCAGGACCCAAT
>probe:Drosophila_2:1624022_at:600:555; Interrogation_Position=979; Antisense; GGACCCAATGGCGTTGTAACAGTTG

Paste this into a BLAST search page for me
ATTGTTACCTTAATCTGTGCGGAGATTGCCTGGCCAGTCAGCTAATCGAAGACCAAGAGTCATGACGCTCCTAGACTAGAGTCCCATTTACTTGAGTACTAGAGGCCCTCTTAATTGCGCAATTGATTGAATACGCTGGCGACGCTTTGCTGCCATGTTTCTTTGTCCAACGTATGAGGACCAGCAATCCATGCAGATCAGATCATCGGCATTACTTTTGACATTATTAGCTTTACGCATGTCCACGAAAGGAACTATGCCTTAAGCTTCTATCAGCTTCTATCAGCCATTCAGGACGAGGAGGCATCTGTGACCAGGACCCAATGGACCCAATGGCGTTGTAACAGTTG

Full Affymetrix probeset data:

Annotations for 1624022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720