FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624023_at:

>probe:Drosophila_2:1624023_at:304:541; Interrogation_Position=1649; Antisense; GGTTAATCAACTGACCGTTCGAGCA
>probe:Drosophila_2:1624023_at:718:193; Interrogation_Position=1657; Antisense; AACTGACCGTTCGAGCAGAGCACCA
>probe:Drosophila_2:1624023_at:9:351; Interrogation_Position=1671; Antisense; GCAGAGCACCAAGCGCATAACCATG
>probe:Drosophila_2:1624023_at:671:555; Interrogation_Position=1732; Antisense; GGACGCCAGTCGGTCACAAAGCATA
>probe:Drosophila_2:1624023_at:559:305; Interrogation_Position=1770; Antisense; CCTGTAGTGCTCGTTGGCCTTAAGA
>probe:Drosophila_2:1624023_at:338:71; Interrogation_Position=1866; Antisense; AGGCGAATGCTTGCCAAGAAGTATA
>probe:Drosophila_2:1624023_at:188:355; Interrogation_Position=1905; Antisense; GCACTAAGTTTCGACCTTGAATCAG
>probe:Drosophila_2:1624023_at:80:701; Interrogation_Position=1935; Antisense; TTTTTGTTCGTCCACAATGCAGTCC
>probe:Drosophila_2:1624023_at:436:231; Interrogation_Position=1950; Antisense; AATGCAGTCCGACCGAATGGACCAG
>probe:Drosophila_2:1624023_at:664:259; Interrogation_Position=2011; Antisense; CAGCGAAATATATTAGTTTGTCCCT
>probe:Drosophila_2:1624023_at:369:575; Interrogation_Position=2029; Antisense; TGTCCCTAAAACTCCTTACCATTCA
>probe:Drosophila_2:1624023_at:553:629; Interrogation_Position=2041; Antisense; TCCTTACCATTCATCAGCTATTCAA
>probe:Drosophila_2:1624023_at:100:35; Interrogation_Position=2053; Antisense; ATCAGCTATTCAAACGTCCGCTTCC
>probe:Drosophila_2:1624023_at:240:633; Interrogation_Position=2069; Antisense; TCCGCTTCCCGTCATTTTAAGGATG

Paste this into a BLAST search page for me
GGTTAATCAACTGACCGTTCGAGCAAACTGACCGTTCGAGCAGAGCACCAGCAGAGCACCAAGCGCATAACCATGGGACGCCAGTCGGTCACAAAGCATACCTGTAGTGCTCGTTGGCCTTAAGAAGGCGAATGCTTGCCAAGAAGTATAGCACTAAGTTTCGACCTTGAATCAGTTTTTGTTCGTCCACAATGCAGTCCAATGCAGTCCGACCGAATGGACCAGCAGCGAAATATATTAGTTTGTCCCTTGTCCCTAAAACTCCTTACCATTCATCCTTACCATTCATCAGCTATTCAAATCAGCTATTCAAACGTCCGCTTCCTCCGCTTCCCGTCATTTTAAGGATG

Full Affymetrix probeset data:

Annotations for 1624023_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720