FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624025_at:

>probe:Drosophila_2:1624025_at:45:641; Interrogation_Position=149; Antisense; TCGGCAACGGCTTTCTGCAGCTGAA
>probe:Drosophila_2:1624025_at:307:387; Interrogation_Position=15; Antisense; GAACAACTTGTCTGTGGGCATCGAG
>probe:Drosophila_2:1624025_at:491:371; Interrogation_Position=171; Antisense; GAAGTCTAGTGCTGGCCAGACGTCG
>probe:Drosophila_2:1624025_at:328:113; Interrogation_Position=235; Antisense; AGCAGCTCGCTGACCGGAAACGGAC
>probe:Drosophila_2:1624025_at:630:329; Interrogation_Position=313; Antisense; GCGTGTGCTTATCAGCTGCAGTTGC
>probe:Drosophila_2:1624025_at:647:289; Interrogation_Position=359; Antisense; CGGAGCAGCCGCAAAACTTCATGGA
>probe:Drosophila_2:1624025_at:433:147; Interrogation_Position=374; Antisense; ACTTCATGGAGTTCCAGGGACCCAT
>probe:Drosophila_2:1624025_at:234:383; Interrogation_Position=39; Antisense; GAACGGCATCCTGGAGTCGTACAAC
>probe:Drosophila_2:1624025_at:304:287; Interrogation_Position=406; Antisense; CTGGTCTACTTGCTGAAGGATCCCA
>probe:Drosophila_2:1624025_at:515:335; Interrogation_Position=438; Antisense; GCTGCTGCACATCTATCTGTTCGAG
>probe:Drosophila_2:1624025_at:505:219; Interrogation_Position=489; Antisense; AAGGTCCTTCGAGAGCCGAATGTCA
>probe:Drosophila_2:1624025_at:318:511; Interrogation_Position=535; Antisense; GTGACCATCGACATGAACTTCTGCC
>probe:Drosophila_2:1624025_at:24:147; Interrogation_Position=62; Antisense; ACTCGGACTTTGAGCTGCAGTTCAG
>probe:Drosophila_2:1624025_at:133:615; Interrogation_Position=95; Antisense; TGAAGCATATCGTCGGCATGTGCCG

Paste this into a BLAST search page for me
TCGGCAACGGCTTTCTGCAGCTGAAGAACAACTTGTCTGTGGGCATCGAGGAAGTCTAGTGCTGGCCAGACGTCGAGCAGCTCGCTGACCGGAAACGGACGCGTGTGCTTATCAGCTGCAGTTGCCGGAGCAGCCGCAAAACTTCATGGAACTTCATGGAGTTCCAGGGACCCATGAACGGCATCCTGGAGTCGTACAACCTGGTCTACTTGCTGAAGGATCCCAGCTGCTGCACATCTATCTGTTCGAGAAGGTCCTTCGAGAGCCGAATGTCAGTGACCATCGACATGAACTTCTGCCACTCGGACTTTGAGCTGCAGTTCAGTGAAGCATATCGTCGGCATGTGCCG

Full Affymetrix probeset data:

Annotations for 1624025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720