FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624027_at:

>probe:Drosophila_2:1624027_at:312:19; Interrogation_Position=179; Antisense; ATTTCCAGCGACTGAGTCAGCTCAG
>probe:Drosophila_2:1624027_at:302:267; Interrogation_Position=201; Antisense; CAGTGCCCAGGAATCGCTTGACGTG
>probe:Drosophila_2:1624027_at:149:195; Interrogation_Position=265; Antisense; AACTGCGATCGGTTGGATGTGCTGT
>probe:Drosophila_2:1624027_at:213:325; Interrogation_Position=312; Antisense; GCGACAAAGCTCCAAACTTCGTGTG
>probe:Drosophila_2:1624027_at:555:677; Interrogation_Position=349; Antisense; TATGACCTGAGACACCTGCAGACAT
>probe:Drosophila_2:1624027_at:451:105; Interrogation_Position=368; Antisense; AGACATCACTGCAGACGGCGCGGGA
>probe:Drosophila_2:1624027_at:13:177; Interrogation_Position=479; Antisense; AAACGCGCCTGCAATTGGACTACGA
>probe:Drosophila_2:1624027_at:113:521; Interrogation_Position=544; Antisense; GTGGACGACATGATTGCCTCGGGCA
>probe:Drosophila_2:1624027_at:487:353; Interrogation_Position=566; Antisense; GCAGCGGCATTCTCGAGAGCCTGAT
>probe:Drosophila_2:1624027_at:642:367; Interrogation_Position=626; Antisense; GAATCCAGGCGATAGGCAGCACACT
>probe:Drosophila_2:1624027_at:372:593; Interrogation_Position=650; Antisense; TGGGTCTGTCCAATCACACGATGAA
>probe:Drosophila_2:1624027_at:383:177; Interrogation_Position=673; Antisense; AAACTTATTGAACGCCGGCTGGTCG
>probe:Drosophila_2:1624027_at:224:85; Interrogation_Position=723; Antisense; AGTGGTGGTCACCTTGCTTATCATC
>probe:Drosophila_2:1624027_at:351:453; Interrogation_Position=753; Antisense; GATCATCTATTTCCTAGTGCTCTAA

Paste this into a BLAST search page for me
ATTTCCAGCGACTGAGTCAGCTCAGCAGTGCCCAGGAATCGCTTGACGTGAACTGCGATCGGTTGGATGTGCTGTGCGACAAAGCTCCAAACTTCGTGTGTATGACCTGAGACACCTGCAGACATAGACATCACTGCAGACGGCGCGGGAAAACGCGCCTGCAATTGGACTACGAGTGGACGACATGATTGCCTCGGGCAGCAGCGGCATTCTCGAGAGCCTGATGAATCCAGGCGATAGGCAGCACACTTGGGTCTGTCCAATCACACGATGAAAAACTTATTGAACGCCGGCTGGTCGAGTGGTGGTCACCTTGCTTATCATCGATCATCTATTTCCTAGTGCTCTAA

Full Affymetrix probeset data:

Annotations for 1624027_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720