FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624028_at:

>probe:Drosophila_2:1624028_at:480:49; Interrogation_Position=1064; Antisense; ATGCCATGGGCCTACATGCGAAGGA
>probe:Drosophila_2:1624028_at:416:383; Interrogation_Position=1093; Antisense; GAACTGGTACAGATGCAGGCCGCGT
>probe:Drosophila_2:1624028_at:175:185; Interrogation_Position=1127; Antisense; AAAAGGCGATCCAGGCGCTGCTGAA
>probe:Drosophila_2:1624028_at:365:271; Interrogation_Position=1176; Antisense; CATCATGGCCCTGACTGTGGGTTAA
>probe:Drosophila_2:1624028_at:563:641; Interrogation_Position=1206; Antisense; TCTGAGTGGCTCCTTTGTATTCAAA
>probe:Drosophila_2:1624028_at:439:661; Interrogation_Position=1255; Antisense; TAACATCCATGTTCGCCATAGAAAT
>probe:Drosophila_2:1624028_at:339:557; Interrogation_Position=1296; Antisense; GGACTTCACTTCTCCTGGTGGATGG
>probe:Drosophila_2:1624028_at:720:305; Interrogation_Position=1309; Antisense; CCTGGTGGATGGCTTGTTCTACAAG
>probe:Drosophila_2:1624028_at:329:369; Interrogation_Position=1333; Antisense; GAATGACAATCTCCGGTGCCAATGT
>probe:Drosophila_2:1624028_at:26:537; Interrogation_Position=1347; Antisense; GGTGCCAATGTAGCTCGTACTATAT
>probe:Drosophila_2:1624028_at:531:383; Interrogation_Position=813; Antisense; GAACATCCTCTTGTACATCGATCAG
>probe:Drosophila_2:1624028_at:435:453; Interrogation_Position=832; Antisense; GATCAGCCGGACGTCTACAGAGTGG
>probe:Drosophila_2:1624028_at:684:433; Interrogation_Position=851; Antisense; GAGTGGCGCACTCGTCGACGTACAT
>probe:Drosophila_2:1624028_at:227:39; Interrogation_Position=889; Antisense; ATCTGCGTGGAGGACACTAGCACCA

Paste this into a BLAST search page for me
ATGCCATGGGCCTACATGCGAAGGAGAACTGGTACAGATGCAGGCCGCGTAAAAGGCGATCCAGGCGCTGCTGAACATCATGGCCCTGACTGTGGGTTAATCTGAGTGGCTCCTTTGTATTCAAATAACATCCATGTTCGCCATAGAAATGGACTTCACTTCTCCTGGTGGATGGCCTGGTGGATGGCTTGTTCTACAAGGAATGACAATCTCCGGTGCCAATGTGGTGCCAATGTAGCTCGTACTATATGAACATCCTCTTGTACATCGATCAGGATCAGCCGGACGTCTACAGAGTGGGAGTGGCGCACTCGTCGACGTACATATCTGCGTGGAGGACACTAGCACCA

Full Affymetrix probeset data:

Annotations for 1624028_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720