FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624029_at:

>probe:Drosophila_2:1624029_at:634:283; Interrogation_Position=1150; Antisense; CTGACGGACAAGTTTCGGTACGATT
>probe:Drosophila_2:1624029_at:146:489; Interrogation_Position=1167; Antisense; GTACGATTATTCCAATCTCTGGCTG
>probe:Drosophila_2:1624029_at:377:643; Interrogation_Position=1182; Antisense; TCTCTGGCTGAGTATCCTTAAGGTG
>probe:Drosophila_2:1624029_at:515:655; Interrogation_Position=1248; Antisense; TAAGGGCGATCTGTACGGTCTTTTC
>probe:Drosophila_2:1624029_at:379:141; Interrogation_Position=1262; Antisense; ACGGTCTTTTCGCATGCATGGTGAC
>probe:Drosophila_2:1624029_at:200:627; Interrogation_Position=1382; Antisense; TGCCGCACATTTCCGACGTATTGGA
>probe:Drosophila_2:1624029_at:437:81; Interrogation_Position=1409; Antisense; AGGTGGACCGTCAGATGCTGCTCAT
>probe:Drosophila_2:1624029_at:391:397; Interrogation_Position=1440; Antisense; GACAAATGACTTGATCCGCGGAATT
>probe:Drosophila_2:1624029_at:73:55; Interrogation_Position=1492; Antisense; ATGACCGCCTTCTGGGTTATGTCCA
>probe:Drosophila_2:1624029_at:560:85; Interrogation_Position=1517; Antisense; AGTGCTGTGTTCAATCTTCGTACGC
>probe:Drosophila_2:1624029_at:291:415; Interrogation_Position=1550; Antisense; GAGCCAAGCAGTCTGATTCCGGATC
>probe:Drosophila_2:1624029_at:240:341; Interrogation_Position=1614; Antisense; GCTTTTCAAGCTCAACTGCTACTAC
>probe:Drosophila_2:1624029_at:346:145; Interrogation_Position=1634; Antisense; ACTACCTCTACCTGGGACTGATTAA
>probe:Drosophila_2:1624029_at:87:17; Interrogation_Position=1658; Antisense; ATTTTGGTTTCCTTGAAGCTCTCAA

Paste this into a BLAST search page for me
CTGACGGACAAGTTTCGGTACGATTGTACGATTATTCCAATCTCTGGCTGTCTCTGGCTGAGTATCCTTAAGGTGTAAGGGCGATCTGTACGGTCTTTTCACGGTCTTTTCGCATGCATGGTGACTGCCGCACATTTCCGACGTATTGGAAGGTGGACCGTCAGATGCTGCTCATGACAAATGACTTGATCCGCGGAATTATGACCGCCTTCTGGGTTATGTCCAAGTGCTGTGTTCAATCTTCGTACGCGAGCCAAGCAGTCTGATTCCGGATCGCTTTTCAAGCTCAACTGCTACTACACTACCTCTACCTGGGACTGATTAAATTTTGGTTTCCTTGAAGCTCTCAA

Full Affymetrix probeset data:

Annotations for 1624029_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720