FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624030_at:

>probe:Drosophila_2:1624030_at:727:223; Interrogation_Position=1017; Antisense; AAGGATCCGCCTTGTATAAGCAGAA
>probe:Drosophila_2:1624030_at:473:161; Interrogation_Position=1109; Antisense; AAATTTTAGTTACGCGACAGCCCTG
>probe:Drosophila_2:1624030_at:62:399; Interrogation_Position=1124; Antisense; GACAGCCCTGGTCCAAATGTTTTTA
>probe:Drosophila_2:1624030_at:104:531; Interrogation_Position=556; Antisense; GGGTGCCTTCCAGTTTGAAATCGAT
>probe:Drosophila_2:1624030_at:467:265; Interrogation_Position=582; Antisense; CAGAGGGCTATGTCATTGTGTACAC
>probe:Drosophila_2:1624030_at:562:729; Interrogation_Position=597; Antisense; TTGTGTACACAGATGGCTCCTGCAT
>probe:Drosophila_2:1624030_at:299:441; Interrogation_Position=608; Antisense; GATGGCTCCTGCATAGGCAACGGAC
>probe:Drosophila_2:1624030_at:415:289; Interrogation_Position=649; Antisense; CGGCTATGGCGTTTATTTCGGCAAG
>probe:Drosophila_2:1624030_at:265:697; Interrogation_Position=664; Antisense; TTTCGGCAAGAATCACCAGCTAAAC
>probe:Drosophila_2:1624030_at:572:175; Interrogation_Position=685; Antisense; AAACGCAGCCAAGCCCGTGGAAGGA
>probe:Drosophila_2:1624030_at:268:31; Interrogation_Position=734; Antisense; ATACAAGCGGCCATTCATGCCATTA
>probe:Drosophila_2:1624030_at:425:179; Interrogation_Position=759; Antisense; AAACAGCTCTTGACTTGGGAATACA
>probe:Drosophila_2:1624030_at:287:347; Interrogation_Position=792; Antisense; GCATCAGCACAGACTCTCAGTTTTT
>probe:Drosophila_2:1624030_at:285:455; Interrogation_Position=817; Antisense; GATCAACTCCATAACGCTGTGGGTT

Paste this into a BLAST search page for me
AAGGATCCGCCTTGTATAAGCAGAAAAATTTTAGTTACGCGACAGCCCTGGACAGCCCTGGTCCAAATGTTTTTAGGGTGCCTTCCAGTTTGAAATCGATCAGAGGGCTATGTCATTGTGTACACTTGTGTACACAGATGGCTCCTGCATGATGGCTCCTGCATAGGCAACGGACCGGCTATGGCGTTTATTTCGGCAAGTTTCGGCAAGAATCACCAGCTAAACAAACGCAGCCAAGCCCGTGGAAGGAATACAAGCGGCCATTCATGCCATTAAAACAGCTCTTGACTTGGGAATACAGCATCAGCACAGACTCTCAGTTTTTGATCAACTCCATAACGCTGTGGGTT

Full Affymetrix probeset data:

Annotations for 1624030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720