FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624032_at:

>probe:Drosophila_2:1624032_at:109:591; Interrogation_Position=397; Antisense; TGGTCAGTGCGGTCAGTCCGTTCAC
>probe:Drosophila_2:1624032_at:23:729; Interrogation_Position=427; Antisense; TTGGCCTGAACACGCCCAGTTGGTG
>probe:Drosophila_2:1624032_at:178:27; Interrogation_Position=476; Antisense; ATACGCCTGCATGATGATCTTCTTC
>probe:Drosophila_2:1624032_at:692:503; Interrogation_Position=533; Antisense; GTCCGGCGCTTTCGAGATAACACTA
>probe:Drosophila_2:1624032_at:705:197; Interrogation_Position=558; Antisense; AACGATGTGCCTGTGTGGTCGAAAC
>probe:Drosophila_2:1624032_at:58:499; Interrogation_Position=575; Antisense; GTCGAAACTGCAGACGGGACGCTTT
>probe:Drosophila_2:1624032_at:102:257; Interrogation_Position=621; Antisense; CAAATCATCGACAACCATCTGCAGT
>probe:Drosophila_2:1624032_at:497:23; Interrogation_Position=686; Antisense; ATAGCATTGGACTGACTGGACGGAC
>probe:Drosophila_2:1624032_at:324:181; Interrogation_Position=745; Antisense; AAAACAGCCGCAGACATCGATTTCC
>probe:Drosophila_2:1624032_at:509:457; Interrogation_Position=763; Antisense; GATTTCCGGCTCTGAACCTAACTTA
>probe:Drosophila_2:1624032_at:531:661; Interrogation_Position=786; Antisense; TAAACATAAGCTCTTGTCCCGACAT
>probe:Drosophila_2:1624032_at:36:629; Interrogation_Position=802; Antisense; TCCCGACATTATCCACTTAGCTGTA
>probe:Drosophila_2:1624032_at:699:601; Interrogation_Position=823; Antisense; TGTATTTCTGTTTTCACCCCAACTA
>probe:Drosophila_2:1624032_at:652:685; Interrogation_Position=846; Antisense; TATAGCCTACTCTACACATCCTAAA

Paste this into a BLAST search page for me
TGGTCAGTGCGGTCAGTCCGTTCACTTGGCCTGAACACGCCCAGTTGGTGATACGCCTGCATGATGATCTTCTTCGTCCGGCGCTTTCGAGATAACACTAAACGATGTGCCTGTGTGGTCGAAACGTCGAAACTGCAGACGGGACGCTTTCAAATCATCGACAACCATCTGCAGTATAGCATTGGACTGACTGGACGGACAAAACAGCCGCAGACATCGATTTCCGATTTCCGGCTCTGAACCTAACTTATAAACATAAGCTCTTGTCCCGACATTCCCGACATTATCCACTTAGCTGTATGTATTTCTGTTTTCACCCCAACTATATAGCCTACTCTACACATCCTAAA

Full Affymetrix probeset data:

Annotations for 1624032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720