FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624033_at:

>probe:Drosophila_2:1624033_at:24:511; Interrogation_Position=4848; Antisense; GTGCAGCGAAAGTCGATATTTTTCA
>probe:Drosophila_2:1624033_at:307:709; Interrogation_Position=4970; Antisense; TTAATTTGTGACTAGCCAGCTTTCG
>probe:Drosophila_2:1624033_at:208:145; Interrogation_Position=4980; Antisense; ACTAGCCAGCTTTCGATCGGTTTAA
>probe:Drosophila_2:1624033_at:22:693; Interrogation_Position=4990; Antisense; TTTCGATCGGTTTAAGCTTAGGCAT
>probe:Drosophila_2:1624033_at:612:115; Interrogation_Position=5004; Antisense; AGCTTAGGCATTATTCGTGGCCCCA
>probe:Drosophila_2:1624033_at:45:523; Interrogation_Position=5020; Antisense; GTGGCCCCATTTTCAGCATAAGTTC
>probe:Drosophila_2:1624033_at:666:263; Interrogation_Position=5032; Antisense; TCAGCATAAGTTCTCATTCGAATTA
>probe:Drosophila_2:1624033_at:548:15; Interrogation_Position=5089; Antisense; ATTTGAACGGCATGAATCTTGGGAT
>probe:Drosophila_2:1624033_at:217:529; Interrogation_Position=5109; Antisense; GGGATTGTTTAGATCACTTGGCTCT
>probe:Drosophila_2:1624033_at:242:573; Interrogation_Position=5128; Antisense; GGCTCTATTGAAAAGATCCGGGCTA
>probe:Drosophila_2:1624033_at:365:363; Interrogation_Position=5144; Antisense; TCCGGGCTAAGATTGTTACCACGTT
>probe:Drosophila_2:1624033_at:227:31; Interrogation_Position=5183; Antisense; ATCAAGGCAAATCAACGGCGCTCCG
>probe:Drosophila_2:1624033_at:585:337; Interrogation_Position=5202; Antisense; GCTCCGCGACACACACATAAACAGA
>probe:Drosophila_2:1624033_at:496:395; Interrogation_Position=5313; Antisense; GAAATCTTACTAGTCAAAGCTTGAA

Paste this into a BLAST search page for me
GTGCAGCGAAAGTCGATATTTTTCATTAATTTGTGACTAGCCAGCTTTCGACTAGCCAGCTTTCGATCGGTTTAATTTCGATCGGTTTAAGCTTAGGCATAGCTTAGGCATTATTCGTGGCCCCAGTGGCCCCATTTTCAGCATAAGTTCTCAGCATAAGTTCTCATTCGAATTAATTTGAACGGCATGAATCTTGGGATGGGATTGTTTAGATCACTTGGCTCTGGCTCTATTGAAAAGATCCGGGCTATCCGGGCTAAGATTGTTACCACGTTATCAAGGCAAATCAACGGCGCTCCGGCTCCGCGACACACACATAAACAGAGAAATCTTACTAGTCAAAGCTTGAA

Full Affymetrix probeset data:

Annotations for 1624033_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720