Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624036_at:

>probe:Drosophila_2:1624036_at:55:143; Interrogation_Position=1533; Antisense; ACTGTTGGCAGTAGCACTCCGAAGC
>probe:Drosophila_2:1624036_at:491:107; Interrogation_Position=1646; Antisense; AGAAGTTGTTTACCCAGTGGATCCA
>probe:Drosophila_2:1624036_at:239:303; Interrogation_Position=1687; Antisense; CCGAGCAGCCTATGGGACCGCAGTT
>probe:Drosophila_2:1624036_at:188:413; Interrogation_Position=1702; Antisense; GACCGCAGTTCGATCCCAACGAGAT
>probe:Drosophila_2:1624036_at:284:449; Interrogation_Position=1724; Antisense; GATCGATTGTACCAACCGTGACTTT
>probe:Drosophila_2:1624036_at:573:511; Interrogation_Position=1741; Antisense; GTGACTTTGTACCACATCCCAATTG
>probe:Drosophila_2:1624036_at:492:247; Interrogation_Position=1761; Antisense; AATTGCCGAAAGTACTTCCGCTGTG
>probe:Drosophila_2:1624036_at:706:489; Interrogation_Position=1772; Antisense; GTACTTCCGCTGTGTCCATGGCAAG
>probe:Drosophila_2:1624036_at:415:269; Interrogation_Position=1788; Antisense; CATGGCAAGCCCGTTGAATTCGAGT
>probe:Drosophila_2:1624036_at:454:613; Interrogation_Position=1812; Antisense; TGCAAGGAGGGAACGGCCTTCCACA
>probe:Drosophila_2:1624036_at:367:155; Interrogation_Position=1834; Antisense; ACACGGTCCTGAATGTCTGCGATTG
>probe:Drosophila_2:1624036_at:346:589; Interrogation_Position=1857; Antisense; TGGATCGAGAACAGCGACCGTTACT
>probe:Drosophila_2:1624036_at:192:413; Interrogation_Position=1872; Antisense; GACCGTTACTACTGCAGTCGAATGA
>probe:Drosophila_2:1624036_at:226:69; Interrogation_Position=1918; Antisense; AGGCCCATTAACTGTCCCAAAATAT

Paste this into a BLAST search page for me
ACTGTTGGCAGTAGCACTCCGAAGCAGAAGTTGTTTACCCAGTGGATCCACCGAGCAGCCTATGGGACCGCAGTTGACCGCAGTTCGATCCCAACGAGATGATCGATTGTACCAACCGTGACTTTGTGACTTTGTACCACATCCCAATTGAATTGCCGAAAGTACTTCCGCTGTGGTACTTCCGCTGTGTCCATGGCAAGCATGGCAAGCCCGTTGAATTCGAGTTGCAAGGAGGGAACGGCCTTCCACAACACGGTCCTGAATGTCTGCGATTGTGGATCGAGAACAGCGACCGTTACTGACCGTTACTACTGCAGTCGAATGAAGGCCCATTAACTGTCCCAAAATAT

Full Affymetrix probeset data:

Annotations for 1624036_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime