FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624038_at:

>probe:Drosophila_2:1624038_at:211:25; Interrogation_Position=1013; Antisense; ATATGTGGTCCAACTCGAATCCAAC
>probe:Drosophila_2:1624038_at:697:251; Interrogation_Position=1037; Antisense; CAAGTGATCCGGAGGCAGCTGCTAA
>probe:Drosophila_2:1624038_at:198:119; Interrogation_Position=1053; Antisense; AGCTGCTAAGCATGTGGCGTCTTTA
>probe:Drosophila_2:1624038_at:617:515; Interrogation_Position=1066; Antisense; GTGGCGTCTTTACTTAGCTTGGGAA
>probe:Drosophila_2:1624038_at:86:159; Interrogation_Position=1157; Antisense; ACACAAAGCTGCGTGGCATTCGTCA
>probe:Drosophila_2:1624038_at:578:359; Interrogation_Position=617; Antisense; GCAACATATTGCTGGCGGACATAAT
>probe:Drosophila_2:1624038_at:15:249; Interrogation_Position=639; Antisense; AATTGACTCGGATACGTGGCGCATT
>probe:Drosophila_2:1624038_at:575:101; Interrogation_Position=774; Antisense; AGAGCAGCTATCGAGCATTGCGCCG
>probe:Drosophila_2:1624038_at:317:533; Interrogation_Position=813; Antisense; GGTGGTAATCCTATGTGTTCTGTTT
>probe:Drosophila_2:1624038_at:271:377; Interrogation_Position=850; Antisense; GAAGAAGCGCTCCAAATTCTCCGGA
>probe:Drosophila_2:1624038_at:204:11; Interrogation_Position=865; Antisense; ATTCTCCGGACATTCGAGGCGGTGA
>probe:Drosophila_2:1624038_at:228:227; Interrogation_Position=895; Antisense; AATCTGGTATTCGTGACCGTCGACG
>probe:Drosophila_2:1624038_at:410:513; Interrogation_Position=943; Antisense; GTGATTTCGGCCAACACCAGTTTTC
>probe:Drosophila_2:1624038_at:514:513; Interrogation_Position=970; Antisense; GTGATCAATTGTACGCCCATTCAAT

Paste this into a BLAST search page for me
ATATGTGGTCCAACTCGAATCCAACCAAGTGATCCGGAGGCAGCTGCTAAAGCTGCTAAGCATGTGGCGTCTTTAGTGGCGTCTTTACTTAGCTTGGGAAACACAAAGCTGCGTGGCATTCGTCAGCAACATATTGCTGGCGGACATAATAATTGACTCGGATACGTGGCGCATTAGAGCAGCTATCGAGCATTGCGCCGGGTGGTAATCCTATGTGTTCTGTTTGAAGAAGCGCTCCAAATTCTCCGGAATTCTCCGGACATTCGAGGCGGTGAAATCTGGTATTCGTGACCGTCGACGGTGATTTCGGCCAACACCAGTTTTCGTGATCAATTGTACGCCCATTCAAT

Full Affymetrix probeset data:

Annotations for 1624038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720