FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624039_at:

>probe:Drosophila_2:1624039_at:449:591; Interrogation_Position=1060; Antisense; TGGTCCTGCAAGGATTGCCCCAAAG
>probe:Drosophila_2:1624039_at:611:23; Interrogation_Position=1115; Antisense; ATATCCGCGCAATCCACGAGAAGGC
>probe:Drosophila_2:1624039_at:662:461; Interrogation_Position=1144; Antisense; GATTATGCCTGCAGCTATTGCGAAA
>probe:Drosophila_2:1624039_at:71:387; Interrogation_Position=1165; Antisense; GAAAAGAAATTTGCCACCACCGACA
>probe:Drosophila_2:1624039_at:719:725; Interrogation_Position=1232; Antisense; TTGAGTGTCACGTTTGCGGCAAGAA
>probe:Drosophila_2:1624039_at:33:397; Interrogation_Position=1254; Antisense; GAAATTTATACAACCCTCTGCCTTG
>probe:Drosophila_2:1624039_at:516:727; Interrogation_Position=1326; Antisense; TTGTGCTCTGCTGCAACTGACTAGC
>probe:Drosophila_2:1624039_at:695:375; Interrogation_Position=789; Antisense; GAAGACCCATATGTGCGAGTTCTGT
>probe:Drosophila_2:1624039_at:489:651; Interrogation_Position=857; Antisense; TCACACACGGTGACCAGCTGGTATT
>probe:Drosophila_2:1624039_at:334:121; Interrogation_Position=872; Antisense; AGCTGGTATTGCCATATGCCTGCGA
>probe:Drosophila_2:1624039_at:340:23; Interrogation_Position=885; Antisense; ATATGCCTGCGAACTGCCGGAATGT
>probe:Drosophila_2:1624039_at:205:215; Interrogation_Position=940; Antisense; AAGATCCACATGATGCGTCACCAGG
>probe:Drosophila_2:1624039_at:434:209; Interrogation_Position=970; Antisense; AAGAACTTTAGTTGCCCCTACTGTG
>probe:Drosophila_2:1624039_at:26:627; Interrogation_Position=982; Antisense; TGCCCCTACTGTGGTCTCAAGAAGA

Paste this into a BLAST search page for me
TGGTCCTGCAAGGATTGCCCCAAAGATATCCGCGCAATCCACGAGAAGGCGATTATGCCTGCAGCTATTGCGAAAGAAAAGAAATTTGCCACCACCGACATTGAGTGTCACGTTTGCGGCAAGAAGAAATTTATACAACCCTCTGCCTTGTTGTGCTCTGCTGCAACTGACTAGCGAAGACCCATATGTGCGAGTTCTGTTCACACACGGTGACCAGCTGGTATTAGCTGGTATTGCCATATGCCTGCGAATATGCCTGCGAACTGCCGGAATGTAAGATCCACATGATGCGTCACCAGGAAGAACTTTAGTTGCCCCTACTGTGTGCCCCTACTGTGGTCTCAAGAAGA

Full Affymetrix probeset data:

Annotations for 1624039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720