FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624040_at:

>probe:Drosophila_2:1624040_at:24:723; Interrogation_Position=104; Antisense; TTGCCGCCCATGGTCGTGTCAACGT
>probe:Drosophila_2:1624040_at:471:65; Interrogation_Position=113; Antisense; ATGGTCGTGTCAACGTCATCAACTC
>probe:Drosophila_2:1624040_at:605:515; Interrogation_Position=119; Antisense; GTGTCAACGTCATCAACTCCATCGG
>probe:Drosophila_2:1624040_at:391:303; Interrogation_Position=185; Antisense; CCGTCGCTGACGGTGATGATGACGT
>probe:Drosophila_2:1624040_at:420:513; Interrogation_Position=197; Antisense; GTGATGATGACGTCGCCACAGGCGC
>probe:Drosophila_2:1624040_at:247:313; Interrogation_Position=211; Antisense; GCCACAGGCGCTACAATCGTTACAG
>probe:Drosophila_2:1624040_at:621:663; Interrogation_Position=222; Antisense; TACAATCGTTACAGCCGCAAGTGCC
>probe:Drosophila_2:1624040_at:616:473; Interrogation_Position=229; Antisense; GTTACAGCCGCAAGTGCCGCAAACA
>probe:Drosophila_2:1624040_at:418:219; Interrogation_Position=240; Antisense; AAGTGCCGCAAACACAAATGTCGCA
>probe:Drosophila_2:1624040_at:500:61; Interrogation_Position=257; Antisense; ATGTCGCAACCGGTGAACACGGCCG
>probe:Drosophila_2:1624040_at:305:347; Interrogation_Position=333; Antisense; GCAGGAACTCCCTTTGGCTGGAAAC
>probe:Drosophila_2:1624040_at:7:631; Interrogation_Position=341; Antisense; TCCCTTTGGCTGGAAACGCTGCGCA
>probe:Drosophila_2:1624040_at:106:561; Interrogation_Position=352; Antisense; GGAAACGCTGCGCAGCACACGCAAG
>probe:Drosophila_2:1624040_at:150:259; Interrogation_Position=369; Antisense; CACGCAAGCTGTCCTACGCCAATGA

Paste this into a BLAST search page for me
TTGCCGCCCATGGTCGTGTCAACGTATGGTCGTGTCAACGTCATCAACTCGTGTCAACGTCATCAACTCCATCGGCCGTCGCTGACGGTGATGATGACGTGTGATGATGACGTCGCCACAGGCGCGCCACAGGCGCTACAATCGTTACAGTACAATCGTTACAGCCGCAAGTGCCGTTACAGCCGCAAGTGCCGCAAACAAAGTGCCGCAAACACAAATGTCGCAATGTCGCAACCGGTGAACACGGCCGGCAGGAACTCCCTTTGGCTGGAAACTCCCTTTGGCTGGAAACGCTGCGCAGGAAACGCTGCGCAGCACACGCAAGCACGCAAGCTGTCCTACGCCAATGA

Full Affymetrix probeset data:

Annotations for 1624040_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720