FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624041_at:

>probe:Drosophila_2:1624041_at:21:595; Interrogation_Position=2759; Antisense; TGTCAAGCCCGCTGACCTAAAGAAG
>probe:Drosophila_2:1624041_at:552:365; Interrogation_Position=2785; Antisense; GAATCGAGTCGCTCATCGACCGCGA
>probe:Drosophila_2:1624041_at:356:461; Interrogation_Position=2871; Antisense; GATTCTGTGAAATCCGAACACCGAT
>probe:Drosophila_2:1624041_at:307:261; Interrogation_Position=2889; Antisense; CACCGATTCGATTGTAATTCGCTCT
>probe:Drosophila_2:1624041_at:272:247; Interrogation_Position=2904; Antisense; AATTCGCTCTATACCATACACATAC
>probe:Drosophila_2:1624041_at:643:611; Interrogation_Position=2944; Antisense; TGAAGTTTTTGGAGTGCCCTCGTCC
>probe:Drosophila_2:1624041_at:5:305; Interrogation_Position=2967; Antisense; CCGATCGGCGATGTTCAGAGTTTTT
>probe:Drosophila_2:1624041_at:600:649; Interrogation_Position=2991; Antisense; TCAGCTGTAATTTCGTTTCTATAAC
>probe:Drosophila_2:1624041_at:585:387; Interrogation_Position=3025; Antisense; GAACAATCCGCCAGCTAATAGTGTA
>probe:Drosophila_2:1624041_at:568:675; Interrogation_Position=3048; Antisense; TAGCGACAGTTCTTTTTGTCATCGC
>probe:Drosophila_2:1624041_at:3:721; Interrogation_Position=3063; Antisense; TTGTCATCGCCCTCGGAACGTCGAT
>probe:Drosophila_2:1624041_at:389:139; Interrogation_Position=3080; Antisense; ACGTCGATGCCTCCAGCAATTTAAA
>probe:Drosophila_2:1624041_at:300:511; Interrogation_Position=3212; Antisense; GTGACATTTGCAGGCTAATTTTCTA
>probe:Drosophila_2:1624041_at:647:193; Interrogation_Position=3259; Antisense; AACTCGTACTAGTAGCTCTGTATGC

Paste this into a BLAST search page for me
TGTCAAGCCCGCTGACCTAAAGAAGGAATCGAGTCGCTCATCGACCGCGAGATTCTGTGAAATCCGAACACCGATCACCGATTCGATTGTAATTCGCTCTAATTCGCTCTATACCATACACATACTGAAGTTTTTGGAGTGCCCTCGTCCCCGATCGGCGATGTTCAGAGTTTTTTCAGCTGTAATTTCGTTTCTATAACGAACAATCCGCCAGCTAATAGTGTATAGCGACAGTTCTTTTTGTCATCGCTTGTCATCGCCCTCGGAACGTCGATACGTCGATGCCTCCAGCAATTTAAAGTGACATTTGCAGGCTAATTTTCTAAACTCGTACTAGTAGCTCTGTATGC

Full Affymetrix probeset data:

Annotations for 1624041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720