FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624042_at:

>probe:Drosophila_2:1624042_at:146:295; Interrogation_Position=4019; Antisense; CGACTCCTAAGTTTTATTGCCGCAC
>probe:Drosophila_2:1624042_at:612:7; Interrogation_Position=4034; Antisense; ATTGCCGCACTCTTTTGCTAAGCTT
>probe:Drosophila_2:1624042_at:197:339; Interrogation_Position=4050; Antisense; GCTAAGCTTTTCATATCGTTCTTTT
>probe:Drosophila_2:1624042_at:18:643; Interrogation_Position=4069; Antisense; TCTTTTACTTTTTCTGTTGCCTAAG
>probe:Drosophila_2:1624042_at:634:467; Interrogation_Position=4084; Antisense; GTTGCCTAAGTTTAAGTTGCCGAAG
>probe:Drosophila_2:1624042_at:364:469; Interrogation_Position=4099; Antisense; GTTGCCGAAGGTTCCCATGGAAGAA
>probe:Drosophila_2:1624042_at:88:139; Interrogation_Position=4131; Antisense; ACTGATATTTGTTTCGTCACGTAAT
>probe:Drosophila_2:1624042_at:340:457; Interrogation_Position=4203; Antisense; GATATCGATGTCAGCTAGCGTCTAA
>probe:Drosophila_2:1624042_at:582:13; Interrogation_Position=4339; Antisense; ATTATCGAACCGGTTGGCTGGCAGC
>probe:Drosophila_2:1624042_at:111:585; Interrogation_Position=4365; Antisense; TGGAACGCGCCAGCTGAACGTCTTA
>probe:Drosophila_2:1624042_at:168:377; Interrogation_Position=4380; Antisense; GAACGTCTTAGTTTCAATTCACTTG
>probe:Drosophila_2:1624042_at:191:35; Interrogation_Position=4507; Antisense; ATCCAATTTAGCACCACGACTACAT
>probe:Drosophila_2:1624042_at:468:489; Interrogation_Position=4535; Antisense; GTAAACCAAACTGAGCAAGCGCCGA
>probe:Drosophila_2:1624042_at:416:359; Interrogation_Position=4549; Antisense; GCAAGCGCCGAAATATTTATCTCTA

Paste this into a BLAST search page for me
CGACTCCTAAGTTTTATTGCCGCACATTGCCGCACTCTTTTGCTAAGCTTGCTAAGCTTTTCATATCGTTCTTTTTCTTTTACTTTTTCTGTTGCCTAAGGTTGCCTAAGTTTAAGTTGCCGAAGGTTGCCGAAGGTTCCCATGGAAGAAACTGATATTTGTTTCGTCACGTAATGATATCGATGTCAGCTAGCGTCTAAATTATCGAACCGGTTGGCTGGCAGCTGGAACGCGCCAGCTGAACGTCTTAGAACGTCTTAGTTTCAATTCACTTGATCCAATTTAGCACCACGACTACATGTAAACCAAACTGAGCAAGCGCCGAGCAAGCGCCGAAATATTTATCTCTA

Full Affymetrix probeset data:

Annotations for 1624042_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720