Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624043_at:

>probe:Drosophila_2:1624043_at:224:363; Interrogation_Position=4102; Antisense; GCAATAGCGCAAATCAGCACGTTTT
>probe:Drosophila_2:1624043_at:237:239; Interrogation_Position=4113; Antisense; AATCAGCACGTTTTCACCACAAAAA
>probe:Drosophila_2:1624043_at:549:251; Interrogation_Position=4177; Antisense; CAAGTTAACCGAACGCGTTCAGTGA
>probe:Drosophila_2:1624043_at:524:51; Interrogation_Position=4280; Antisense; ATGCAATCTAAAGGCCCGACAAATT
>probe:Drosophila_2:1624043_at:211:261; Interrogation_Position=4349; Antisense; CACGCCCTTACGTTCATTGGAAGTT
>probe:Drosophila_2:1624043_at:659:679; Interrogation_Position=4365; Antisense; TTGGAAGTTCCAGTCCGGGTTCCAG
>probe:Drosophila_2:1624043_at:131:323; Interrogation_Position=4420; Antisense; GCGCGAAAAACAGCTGCATTGCTCC
>probe:Drosophila_2:1624043_at:647:273; Interrogation_Position=4444; Antisense; CATTCCCACACGCTGAGGTGAGTAA
>probe:Drosophila_2:1624043_at:603:339; Interrogation_Position=4493; Antisense; GCATTCTTTTTATCGGCAATTCCCG
>probe:Drosophila_2:1624043_at:510:245; Interrogation_Position=4518; Antisense; CAATTACTCTCTCTACGTTTACGTT
>probe:Drosophila_2:1624043_at:473:633; Interrogation_Position=4544; Antisense; TCCCTCGCGGCGACCATTGAAAAAT
>probe:Drosophila_2:1624043_at:522:165; Interrogation_Position=4565; Antisense; AAATCGCCGAAGGTCGCGTTTCCAT
>probe:Drosophila_2:1624043_at:293:641; Interrogation_Position=4583; Antisense; TTTCCATGTCCTTTAAAGTCCCCAT
>probe:Drosophila_2:1624043_at:446:613; Interrogation_Position=4649; Antisense; TGAAGTTCCGCCCATTTTCTATTAA

Paste this into a BLAST search page for me
GCAATAGCGCAAATCAGCACGTTTTAATCAGCACGTTTTCACCACAAAAACAAGTTAACCGAACGCGTTCAGTGAATGCAATCTAAAGGCCCGACAAATTCACGCCCTTACGTTCATTGGAAGTTTTGGAAGTTCCAGTCCGGGTTCCAGGCGCGAAAAACAGCTGCATTGCTCCCATTCCCACACGCTGAGGTGAGTAAGCATTCTTTTTATCGGCAATTCCCGCAATTACTCTCTCTACGTTTACGTTTCCCTCGCGGCGACCATTGAAAAATAAATCGCCGAAGGTCGCGTTTCCATTTTCCATGTCCTTTAAAGTCCCCATTGAAGTTCCGCCCATTTTCTATTAA

Full Affymetrix probeset data:

Annotations for 1624043_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime