Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624044_at:

>probe:Drosophila_2:1624044_at:567:185; Interrogation_Position=124; Antisense; AACAAAGATCTGCTTGGCCAGCTCC
>probe:Drosophila_2:1624044_at:514:155; Interrogation_Position=158; Antisense; ACAGCTCAGCGAAGCATTGCTCTTA
>probe:Drosophila_2:1624044_at:507:1; Interrogation_Position=19; Antisense; AGGCTTCTTTACCTAATGGTGACAA
>probe:Drosophila_2:1624044_at:109:273; Interrogation_Position=196; Antisense; CATTGATCAGAAGTGGCGTGCAGCC
>probe:Drosophila_2:1624044_at:661:463; Interrogation_Position=225; Antisense; GATTGCCGGAAAACCCAAATGCCTT
>probe:Drosophila_2:1624044_at:533:281; Interrogation_Position=266; Antisense; CTGCCCGACTACACGTACTTAGATG
>probe:Drosophila_2:1624044_at:180:489; Interrogation_Position=280; Antisense; GTACTTAGATGGTAGGCCCACGCCG
>probe:Drosophila_2:1624044_at:593:505; Interrogation_Position=309; Antisense; GTGCCAACCAGAAGAGGCGCCTGAT
>probe:Drosophila_2:1624044_at:440:449; Interrogation_Position=346; Antisense; GATCGCCACCAGGATCGTGGAGCTA
>probe:Drosophila_2:1624044_at:553:511; Interrogation_Position=37; Antisense; GTGACAACACTGCAGTCAGCTGTTT
>probe:Drosophila_2:1624044_at:395:311; Interrogation_Position=389; Antisense; GCCAAGCAGCGACATGAACGCCTTA
>probe:Drosophila_2:1624044_at:365:47; Interrogation_Position=420; Antisense; ATGCCGAGTCCGAGAAACAGCGCCT
>probe:Drosophila_2:1624044_at:575:521; Interrogation_Position=469; Antisense; GGGCCACTTCCTGCTCAAGAAATAG
>probe:Drosophila_2:1624044_at:242:27; Interrogation_Position=490; Antisense; ATAGCGTCCTAGTCTTAGCCAGTAT

Paste this into a BLAST search page for me
AACAAAGATCTGCTTGGCCAGCTCCACAGCTCAGCGAAGCATTGCTCTTAAGGCTTCTTTACCTAATGGTGACAACATTGATCAGAAGTGGCGTGCAGCCGATTGCCGGAAAACCCAAATGCCTTCTGCCCGACTACACGTACTTAGATGGTACTTAGATGGTAGGCCCACGCCGGTGCCAACCAGAAGAGGCGCCTGATGATCGCCACCAGGATCGTGGAGCTAGTGACAACACTGCAGTCAGCTGTTTGCCAAGCAGCGACATGAACGCCTTAATGCCGAGTCCGAGAAACAGCGCCTGGGCCACTTCCTGCTCAAGAAATAGATAGCGTCCTAGTCTTAGCCAGTAT

Full Affymetrix probeset data:

Annotations for 1624044_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime