FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624048_at:

>probe:Drosophila_2:1624048_at:239:57; Interrogation_Position=458; Antisense; ATGTAACCTACAAGACGATCGCGTC
>probe:Drosophila_2:1624048_at:182:451; Interrogation_Position=474; Antisense; GATCGCGTCTGATACTATTAGCCAT
>probe:Drosophila_2:1624048_at:305:603; Interrogation_Position=535; Antisense; TGTTATCACAGCCATGACTTCGTCT
>probe:Drosophila_2:1624048_at:415:649; Interrogation_Position=628; Antisense; TCACGAAACGTCTTCTGGGCCGAAA
>probe:Drosophila_2:1624048_at:86:67; Interrogation_Position=652; Antisense; ATGGAGGAGGTGTCCTGCATCCTGC
>probe:Drosophila_2:1624048_at:355:597; Interrogation_Position=714; Antisense; TGTGCACGACGACACGATTGCTTTT
>probe:Drosophila_2:1624048_at:76:465; Interrogation_Position=729; Antisense; GATTGCTTTTGTTGCCAAGGGTCTC
>probe:Drosophila_2:1624048_at:650:521; Interrogation_Position=823; Antisense; GTGGCCGCCATTGTCATGGACAGGA
>probe:Drosophila_2:1624048_at:482:61; Interrogation_Position=838; Antisense; ATGGACAGGAAGTCGGCCGTTGTAA
>probe:Drosophila_2:1624048_at:461:67; Interrogation_Position=862; Antisense; ATGGCATATGCCGTGAACCACTTCG
>probe:Drosophila_2:1624048_at:205:465; Interrogation_Position=886; Antisense; GTTCCTCAGACCATGACCGATGACA
>probe:Drosophila_2:1624048_at:184:241; Interrogation_Position=940; Antisense; AATAACGTCATTCGCGGATTTGCCA
>probe:Drosophila_2:1624048_at:436:261; Interrogation_Position=973; Antisense; CACCTCCGTCGTATCATTATCAAAA
>probe:Drosophila_2:1624048_at:26:271; Interrogation_Position=987; Antisense; CATTATCAAAAAGACCTGCCCCGTT

Paste this into a BLAST search page for me
ATGTAACCTACAAGACGATCGCGTCGATCGCGTCTGATACTATTAGCCATTGTTATCACAGCCATGACTTCGTCTTCACGAAACGTCTTCTGGGCCGAAAATGGAGGAGGTGTCCTGCATCCTGCTGTGCACGACGACACGATTGCTTTTGATTGCTTTTGTTGCCAAGGGTCTCGTGGCCGCCATTGTCATGGACAGGAATGGACAGGAAGTCGGCCGTTGTAAATGGCATATGCCGTGAACCACTTCGGTTCCTCAGACCATGACCGATGACAAATAACGTCATTCGCGGATTTGCCACACCTCCGTCGTATCATTATCAAAACATTATCAAAAAGACCTGCCCCGTT

Full Affymetrix probeset data:

Annotations for 1624048_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720