FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624050_at:

>probe:Drosophila_2:1624050_at:13:247; Interrogation_Position=1479; Antisense; AATTCACAGAGGACTTTGGGCAGGA
>probe:Drosophila_2:1624050_at:695:549; Interrogation_Position=1501; Antisense; GGAGGGCTAGACACGAACCCCGCCA
>probe:Drosophila_2:1624050_at:88:355; Interrogation_Position=1536; Antisense; GCACCACCAGCTAATTCTAATTGTT
>probe:Drosophila_2:1624050_at:137:651; Interrogation_Position=1576; Antisense; TCAAACACGTTTTACTTCTGGCTCT
>probe:Drosophila_2:1624050_at:571:147; Interrogation_Position=1589; Antisense; ACTTCTGGCTCTCCTTAAACATTTT
>probe:Drosophila_2:1624050_at:712:689; Interrogation_Position=1674; Antisense; TTTGTCGTTCGATTGCAACCGGAGA
>probe:Drosophila_2:1624050_at:360:375; Interrogation_Position=1792; Antisense; GAAGAAACCCGATATCCAGCCTGAA
>probe:Drosophila_2:1624050_at:505:673; Interrogation_Position=1804; Antisense; TATCCAGCCTGAAGTTTGAAACCTA
>probe:Drosophila_2:1624050_at:171:231; Interrogation_Position=1828; Antisense; AATGTAATATGAGTGTCCGCCGCGC
>probe:Drosophila_2:1624050_at:663:343; Interrogation_Position=1851; Antisense; GCTTGCGCAATATTTGCCACTCGGA
>probe:Drosophila_2:1624050_at:22:19; Interrogation_Position=1862; Antisense; ATTTGCCACTCGGACTTGCCACGGA
>probe:Drosophila_2:1624050_at:639:719; Interrogation_Position=1877; Antisense; TTGCCACGGACACCTCAGATCAGAG
>probe:Drosophila_2:1624050_at:428:453; Interrogation_Position=1894; Antisense; GATCAGAGCAGCACCAATCAGCGGA
>probe:Drosophila_2:1624050_at:314:659; Interrogation_Position=1988; Antisense; TAAGCGCAGTCGAGCAAACCTATTT

Paste this into a BLAST search page for me
AATTCACAGAGGACTTTGGGCAGGAGGAGGGCTAGACACGAACCCCGCCAGCACCACCAGCTAATTCTAATTGTTTCAAACACGTTTTACTTCTGGCTCTACTTCTGGCTCTCCTTAAACATTTTTTTGTCGTTCGATTGCAACCGGAGAGAAGAAACCCGATATCCAGCCTGAATATCCAGCCTGAAGTTTGAAACCTAAATGTAATATGAGTGTCCGCCGCGCGCTTGCGCAATATTTGCCACTCGGAATTTGCCACTCGGACTTGCCACGGATTGCCACGGACACCTCAGATCAGAGGATCAGAGCAGCACCAATCAGCGGATAAGCGCAGTCGAGCAAACCTATTT

Full Affymetrix probeset data:

Annotations for 1624050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720