FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624051_at:

>probe:Drosophila_2:1624051_at:134:683; Interrogation_Position=1315; Antisense; TATGCCCAGTTAATAGCCACAGATT
>probe:Drosophila_2:1624051_at:207:311; Interrogation_Position=1330; Antisense; GCCACAGATTACAAGGGTCCACTAT
>probe:Drosophila_2:1624051_at:373:87; Interrogation_Position=1366; Antisense; AGTCCTGTCTATCAGGTGCCCATGG
>probe:Drosophila_2:1624051_at:549:623; Interrogation_Position=1382; Antisense; TGCCCATGGCTCATCCTAAAGCAAA
>probe:Drosophila_2:1624051_at:220:99; Interrogation_Position=1431; Antisense; AGATGCCCTGAAAAGTCTGCTGCCG
>probe:Drosophila_2:1624051_at:249:627; Interrogation_Position=1451; Antisense; TGCCGGCCAGCAATCATTTACAAAC
>probe:Drosophila_2:1624051_at:68:525; Interrogation_Position=1494; Antisense; GGGCTTCCTTATAGATGCACTGTGC
>probe:Drosophila_2:1624051_at:240:355; Interrogation_Position=1510; Antisense; GCACTGTGCCATTTTGATGCTAACA
>probe:Drosophila_2:1624051_at:482:251; Interrogation_Position=1579; Antisense; CAAGGTGGCGCTGATGGTCATCGAT
>probe:Drosophila_2:1624051_at:9:637; Interrogation_Position=1599; Antisense; TCGATTTCCATGACATTTGCCACGG
>probe:Drosophila_2:1624051_at:602:19; Interrogation_Position=1613; Antisense; ATTTGCCACGGAACGCATCGCAGTG
>probe:Drosophila_2:1624051_at:436:119; Interrogation_Position=1640; Antisense; AGCGGCGTTACGAATCTGACATTTG
>probe:Drosophila_2:1624051_at:27:287; Interrogation_Position=1678; Antisense; GAGTGGTTACCACGTTATTCCCGTG
>probe:Drosophila_2:1624051_at:685:719; Interrogation_Position=1695; Antisense; TTCCCGTGCCCTATAATGAGTTCAG

Paste this into a BLAST search page for me
TATGCCCAGTTAATAGCCACAGATTGCCACAGATTACAAGGGTCCACTATAGTCCTGTCTATCAGGTGCCCATGGTGCCCATGGCTCATCCTAAAGCAAAAGATGCCCTGAAAAGTCTGCTGCCGTGCCGGCCAGCAATCATTTACAAACGGGCTTCCTTATAGATGCACTGTGCGCACTGTGCCATTTTGATGCTAACACAAGGTGGCGCTGATGGTCATCGATTCGATTTCCATGACATTTGCCACGGATTTGCCACGGAACGCATCGCAGTGAGCGGCGTTACGAATCTGACATTTGGAGTGGTTACCACGTTATTCCCGTGTTCCCGTGCCCTATAATGAGTTCAG

Full Affymetrix probeset data:

Annotations for 1624051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720