Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624052_at:

>probe:Drosophila_2:1624052_at:346:571; Interrogation_Position=1107; Antisense; GGCTTCGACTACTTGAATCGCGTGT
>probe:Drosophila_2:1624052_at:391:403; Interrogation_Position=1113; Antisense; GACTACTTGAATCGCGTGTTGACCG
>probe:Drosophila_2:1624052_at:451:149; Interrogation_Position=1117; Antisense; ACTTGAATCGCGTGTTGACCGTGGA
>probe:Drosophila_2:1624052_at:170:365; Interrogation_Position=1121; Antisense; GAATCGCGTGTTGACCGTGGACCAG
>probe:Drosophila_2:1624052_at:447:45; Interrogation_Position=1123; Antisense; ATCGCGTGTTGACCGTGGACCAGCC
>probe:Drosophila_2:1624052_at:383:587; Interrogation_Position=1138; Antisense; TGGACCAGCCCACGGAGCATTTGCC
>probe:Drosophila_2:1624052_at:703:113; Interrogation_Position=1153; Antisense; AGCATTTGCCGCAGCGAATTGTGGA
>probe:Drosophila_2:1624052_at:234:695; Interrogation_Position=1157; Antisense; TTTGCCGCAGCGAATTGTGGACGCC
>probe:Drosophila_2:1624052_at:459:297; Interrogation_Position=1162; Antisense; CGCAGCGAATTGTGGACGCCCGCAG
>probe:Drosophila_2:1624052_at:61:573; Interrogation_Position=1188; Antisense; GGCTCACTTGCCAATACTAATTCAT
>probe:Drosophila_2:1624052_at:317:719; Interrogation_Position=1195; Antisense; TTGCCAATACTAATTCATCCGAGGG
>probe:Drosophila_2:1624052_at:111:249; Interrogation_Position=1199; Antisense; CAATACTAATTCATCCGAGGGCGGA
>probe:Drosophila_2:1624052_at:618:653; Interrogation_Position=1205; Antisense; TAATTCATCCGAGGGCGGATCATCC
>probe:Drosophila_2:1624052_at:94:295; Interrogation_Position=1214; Antisense; CGAGGGCGGATCATCCTCATCCAGC

Paste this into a BLAST search page for me
GGCTTCGACTACTTGAATCGCGTGTGACTACTTGAATCGCGTGTTGACCGACTTGAATCGCGTGTTGACCGTGGAGAATCGCGTGTTGACCGTGGACCAGATCGCGTGTTGACCGTGGACCAGCCTGGACCAGCCCACGGAGCATTTGCCAGCATTTGCCGCAGCGAATTGTGGATTTGCCGCAGCGAATTGTGGACGCCCGCAGCGAATTGTGGACGCCCGCAGGGCTCACTTGCCAATACTAATTCATTTGCCAATACTAATTCATCCGAGGGCAATACTAATTCATCCGAGGGCGGATAATTCATCCGAGGGCGGATCATCCCGAGGGCGGATCATCCTCATCCAGC

Full Affymetrix probeset data:

Annotations for 1624052_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime