FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624053_at:

>probe:Drosophila_2:1624053_at:452:163; Interrogation_Position=363; Antisense; AAATAATTGAGAGCGCGCCCGCGCT
>probe:Drosophila_2:1624053_at:267:299; Interrogation_Position=408; Antisense; CGCGCGTGTGTATTCGAGTTGGCTC
>probe:Drosophila_2:1624053_at:184:429; Interrogation_Position=423; Antisense; GAGTTGGCTCGGTGTGTGCCTCTAC
>probe:Drosophila_2:1624053_at:672:303; Interrogation_Position=450; Antisense; CCGTCACCGTGTGGCCGTGTTGTGT
>probe:Drosophila_2:1624053_at:95:517; Interrogation_Position=481; Antisense; GTGTGCGGGTCGGTCTCCATTATCG
>probe:Drosophila_2:1624053_at:371:537; Interrogation_Position=492; Antisense; GGTCTCCATTATCGCCGGAGCAAAA
>probe:Drosophila_2:1624053_at:579:165; Interrogation_Position=633; Antisense; AAATCCAGCAACAACGACGTTTTCT
>probe:Drosophila_2:1624053_at:84:293; Interrogation_Position=647; Antisense; CGACGTTTTCTCAGACTAACCAAAG
>probe:Drosophila_2:1624053_at:325:405; Interrogation_Position=660; Antisense; GACTAACCAAAGTACACGGCGAGAA
>probe:Drosophila_2:1624053_at:388:367; Interrogation_Position=701; Antisense; GAATCTGCAACAAACCGCATCGCAA
>probe:Drosophila_2:1624053_at:565:717; Interrogation_Position=855; Antisense; TTCCCACTTCCCGATGGCTGGGATA
>probe:Drosophila_2:1624053_at:548:457; Interrogation_Position=876; Antisense; GATATCGCCAAGGATTTCGATGGCA
>probe:Drosophila_2:1624053_at:11:687; Interrogation_Position=920; Antisense; TATCAACAAGAAGACCACCTGGCTG
>probe:Drosophila_2:1624053_at:59:261; Interrogation_Position=935; Antisense; CACCTGGCTGGATCCCAGAGATTGG

Paste this into a BLAST search page for me
AAATAATTGAGAGCGCGCCCGCGCTCGCGCGTGTGTATTCGAGTTGGCTCGAGTTGGCTCGGTGTGTGCCTCTACCCGTCACCGTGTGGCCGTGTTGTGTGTGTGCGGGTCGGTCTCCATTATCGGGTCTCCATTATCGCCGGAGCAAAAAAATCCAGCAACAACGACGTTTTCTCGACGTTTTCTCAGACTAACCAAAGGACTAACCAAAGTACACGGCGAGAAGAATCTGCAACAAACCGCATCGCAATTCCCACTTCCCGATGGCTGGGATAGATATCGCCAAGGATTTCGATGGCATATCAACAAGAAGACCACCTGGCTGCACCTGGCTGGATCCCAGAGATTGG

Full Affymetrix probeset data:

Annotations for 1624053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720