Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624054_at:

>probe:Drosophila_2:1624054_at:334:11; Interrogation_Position=2028; Antisense; ATTCGCATCCACTCAGAGCCATATC
>probe:Drosophila_2:1624054_at:338:23; Interrogation_Position=2048; Antisense; ATATCCATGCCCACATCCTCAATAT
>probe:Drosophila_2:1624054_at:290:95; Interrogation_Position=2088; Antisense; AGCTAATCGTTATGGACTAGTCCTT
>probe:Drosophila_2:1624054_at:151:451; Interrogation_Position=2118; Antisense; GATCTAGGCTAATACCTCTCTGTAA
>probe:Drosophila_2:1624054_at:458:491; Interrogation_Position=2139; Antisense; GTAAACCCATGAGATTCTGTCCCAC
>probe:Drosophila_2:1624054_at:702:259; Interrogation_Position=2161; Antisense; CACGCCCCTAAAACTGTTTCAATCT
>probe:Drosophila_2:1624054_at:572:235; Interrogation_Position=2181; Antisense; AATCTAAAATCCGTTGCTGCGCCGA
>probe:Drosophila_2:1624054_at:319:469; Interrogation_Position=2193; Antisense; GTTGCTGCGCCGAAGAATCCGAAAG
>probe:Drosophila_2:1624054_at:236:251; Interrogation_Position=2280; Antisense; CAAAGAAGCCTGAACGTAATCGTAA
>probe:Drosophila_2:1624054_at:131:427; Interrogation_Position=2306; Antisense; GAGTTAGCCAGTCATGCGGTTCCGA
>probe:Drosophila_2:1624054_at:381:623; Interrogation_Position=2320; Antisense; TGCGGTTCCGAATCACTCAGAGATG
>probe:Drosophila_2:1624054_at:263:47; Interrogation_Position=2392; Antisense; ATGCAAACTTCCTACTACAGTAATG
>probe:Drosophila_2:1624054_at:30:53; Interrogation_Position=2414; Antisense; ATGCATTTGCATTTTAGCCTATGAG
>probe:Drosophila_2:1624054_at:281:659; Interrogation_Position=2500; Antisense; TAAGCTGCAGTGTAAATTTGTTCGC

Paste this into a BLAST search page for me
ATTCGCATCCACTCAGAGCCATATCATATCCATGCCCACATCCTCAATATAGCTAATCGTTATGGACTAGTCCTTGATCTAGGCTAATACCTCTCTGTAAGTAAACCCATGAGATTCTGTCCCACCACGCCCCTAAAACTGTTTCAATCTAATCTAAAATCCGTTGCTGCGCCGAGTTGCTGCGCCGAAGAATCCGAAAGCAAAGAAGCCTGAACGTAATCGTAAGAGTTAGCCAGTCATGCGGTTCCGATGCGGTTCCGAATCACTCAGAGATGATGCAAACTTCCTACTACAGTAATGATGCATTTGCATTTTAGCCTATGAGTAAGCTGCAGTGTAAATTTGTTCGC

Full Affymetrix probeset data:

Annotations for 1624054_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime