FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624057_at:

>probe:Drosophila_2:1624057_at:256:179; Interrogation_Position=124; Antisense; AAAATGCAATCTGTGGTCTACCCCA
>probe:Drosophila_2:1624057_at:645:655; Interrogation_Position=142; Antisense; TACCCCATTCCCTAAACGGAGATGG
>probe:Drosophila_2:1624057_at:30:481; Interrogation_Position=16; Antisense; GTTTGCTCTCATCGCAATCAGCTAA
>probe:Drosophila_2:1624057_at:84:441; Interrogation_Position=162; Antisense; GATGGCAGAATATCCTGTGAGGCCT
>probe:Drosophila_2:1624057_at:384:509; Interrogation_Position=178; Antisense; GTGAGGCCTATATACCCAGTTGGTC
>probe:Drosophila_2:1624057_at:650:685; Interrogation_Position=186; Antisense; TATATACCCAGTTGGTCCTACGACG
>probe:Drosophila_2:1624057_at:118:631; Interrogation_Position=201; Antisense; TCCTACGACGCCGATCGAAACGAGT
>probe:Drosophila_2:1624057_at:24:173; Interrogation_Position=218; Antisense; AAACGAGTGCGTCAAATTTATCTAC
>probe:Drosophila_2:1624057_at:302:15; Interrogation_Position=233; Antisense; ATTTATCTACGGAGGCTGCGGAGGC
>probe:Drosophila_2:1624057_at:508:165; Interrogation_Position=283; Antisense; AAATCTGTGAAGACAAGTGTTTGCA
>probe:Drosophila_2:1624057_at:501:115; Interrogation_Position=35; Antisense; AGCTAAAGGTTTTGAATATCTCTGA
>probe:Drosophila_2:1624057_at:327:365; Interrogation_Position=48; Antisense; GAATATCTCTGAACTATGAAACTGT
>probe:Drosophila_2:1624057_at:69:461; Interrogation_Position=74; Antisense; GATTTTGGTTTTCGTGTTTGTCGCT
>probe:Drosophila_2:1624057_at:562:601; Interrogation_Position=88; Antisense; TGTTTGTCGCTTTTGTGGCCAACGC

Paste this into a BLAST search page for me
AAAATGCAATCTGTGGTCTACCCCATACCCCATTCCCTAAACGGAGATGGGTTTGCTCTCATCGCAATCAGCTAAGATGGCAGAATATCCTGTGAGGCCTGTGAGGCCTATATACCCAGTTGGTCTATATACCCAGTTGGTCCTACGACGTCCTACGACGCCGATCGAAACGAGTAAACGAGTGCGTCAAATTTATCTACATTTATCTACGGAGGCTGCGGAGGCAAATCTGTGAAGACAAGTGTTTGCAAGCTAAAGGTTTTGAATATCTCTGAGAATATCTCTGAACTATGAAACTGTGATTTTGGTTTTCGTGTTTGTCGCTTGTTTGTCGCTTTTGTGGCCAACGC

Full Affymetrix probeset data:

Annotations for 1624057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720