Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624058_at:

>probe:Drosophila_2:1624058_at:117:347; Interrogation_Position=6064; Antisense; GCATCATGCAAATGGATCGCTCTTT
>probe:Drosophila_2:1624058_at:349:449; Interrogation_Position=6078; Antisense; GATCGCTCTTTCAAACGCTAGCAGG
>probe:Drosophila_2:1624058_at:455:553; Interrogation_Position=6103; Antisense; GGAGCATGGAGCACGCCATCTGACA
>probe:Drosophila_2:1624058_at:476:307; Interrogation_Position=6118; Antisense; CCATCTGACATCGTTGCGGGTACGA
>probe:Drosophila_2:1624058_at:276:489; Interrogation_Position=6137; Antisense; GTACGAGATGAGACGCTGCTAGCAT
>probe:Drosophila_2:1624058_at:74:17; Interrogation_Position=6160; Antisense; ATTTATGGAGGGATGCTGCCGTATA
>probe:Drosophila_2:1624058_at:176:659; Interrogation_Position=6183; Antisense; TAAGAGTGCTTATCTACCGCGGTGT
>probe:Drosophila_2:1624058_at:462:347; Interrogation_Position=6208; Antisense; GCAGGGATTCGTGGACTTTGTCCGT
>probe:Drosophila_2:1624058_at:69:549; Interrogation_Position=6271; Antisense; GGAGGTCTTGCAGTTACTATCCCTA
>probe:Drosophila_2:1624058_at:197:313; Interrogation_Position=6313; Antisense; GCCACCCGGAGCCATGTACTTATTG
>probe:Drosophila_2:1624058_at:157:585; Interrogation_Position=6336; Antisense; TGGCAGTGGTTCAAGCTCGACGCGT
>probe:Drosophila_2:1624058_at:698:635; Interrogation_Position=6352; Antisense; TCGACGCGTCACTTTCTACGAAGTG
>probe:Drosophila_2:1624058_at:594:589; Interrogation_Position=6375; Antisense; TGGTGGTAGCCGGATTACTAGAGCC
>probe:Drosophila_2:1624058_at:254:571; Interrogation_Position=6402; Antisense; GGCTCCAGTGCCCATGATTGTTAAA

Paste this into a BLAST search page for me
GCATCATGCAAATGGATCGCTCTTTGATCGCTCTTTCAAACGCTAGCAGGGGAGCATGGAGCACGCCATCTGACACCATCTGACATCGTTGCGGGTACGAGTACGAGATGAGACGCTGCTAGCATATTTATGGAGGGATGCTGCCGTATATAAGAGTGCTTATCTACCGCGGTGTGCAGGGATTCGTGGACTTTGTCCGTGGAGGTCTTGCAGTTACTATCCCTAGCCACCCGGAGCCATGTACTTATTGTGGCAGTGGTTCAAGCTCGACGCGTTCGACGCGTCACTTTCTACGAAGTGTGGTGGTAGCCGGATTACTAGAGCCGGCTCCAGTGCCCATGATTGTTAAA

Full Affymetrix probeset data:

Annotations for 1624058_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime