FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624060_at:

>probe:Drosophila_2:1624060_at:176:39; Interrogation_Position=4540; Antisense; ATGTTGTCAAATCCGGTAATCACCA
>probe:Drosophila_2:1624060_at:48:155; Interrogation_Position=4647; Antisense; ACAGATAGACGTGCATACCGTACCA
>probe:Drosophila_2:1624060_at:179:669; Interrogation_Position=4662; Antisense; TACCGTACCACGCACGTACATAAAC
>probe:Drosophila_2:1624060_at:247:23; Interrogation_Position=4737; Antisense; ATAGCTTTAGGCTTCGACTTAATCT
>probe:Drosophila_2:1624060_at:584:301; Interrogation_Position=4788; Antisense; CCGCACTTCTTCTATGGTAATCGTA
>probe:Drosophila_2:1624060_at:669:229; Interrogation_Position=4826; Antisense; AATGGGCAAACAACGCAGGCAGCAT
>probe:Drosophila_2:1624060_at:451:135; Interrogation_Position=4838; Antisense; ACGCAGGCAGCATCACATTAAATTT
>probe:Drosophila_2:1624060_at:275:95; Interrogation_Position=4906; Antisense; AGATTACACAATACCATACCACCAC
>probe:Drosophila_2:1624060_at:70:67; Interrogation_Position=4931; Antisense; ATGGCACACACACTCGACTGTCAGA
>probe:Drosophila_2:1624060_at:189:405; Interrogation_Position=4946; Antisense; GACTGTCAGATACGCATATGTGTGT
>probe:Drosophila_2:1624060_at:616:59; Interrogation_Position=4973; Antisense; ATGTGCATATGTATTGTCCGAACTG
>probe:Drosophila_2:1624060_at:91:503; Interrogation_Position=4988; Antisense; GTCCGAACTGCGTGGGTGAAAACTA
>probe:Drosophila_2:1624060_at:88:707; Interrogation_Position=5046; Antisense; TTACCTAACCCTAGAGATGCGCGAG
>probe:Drosophila_2:1624060_at:709:431; Interrogation_Position=5068; Antisense; GAGGCATTCTTGAGTTTAGTTAAAC

Paste this into a BLAST search page for me
ATGTTGTCAAATCCGGTAATCACCAACAGATAGACGTGCATACCGTACCATACCGTACCACGCACGTACATAAACATAGCTTTAGGCTTCGACTTAATCTCCGCACTTCTTCTATGGTAATCGTAAATGGGCAAACAACGCAGGCAGCATACGCAGGCAGCATCACATTAAATTTAGATTACACAATACCATACCACCACATGGCACACACACTCGACTGTCAGAGACTGTCAGATACGCATATGTGTGTATGTGCATATGTATTGTCCGAACTGGTCCGAACTGCGTGGGTGAAAACTATTACCTAACCCTAGAGATGCGCGAGGAGGCATTCTTGAGTTTAGTTAAAC

Full Affymetrix probeset data:

Annotations for 1624060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720