FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624061_at:

>probe:Drosophila_2:1624061_at:43:317; Interrogation_Position=248; Antisense; GCCGGCGCCTACACAGAACAGGTGC
>probe:Drosophila_2:1624061_at:508:491; Interrogation_Position=25; Antisense; GTAAATCACTTAGTTCATCATGCAG
>probe:Drosophila_2:1624061_at:449:187; Interrogation_Position=264; Antisense; AACAGGTGCCCCACTACGTGGGAAG
>probe:Drosophila_2:1624061_at:378:593; Interrogation_Position=282; Antisense; TGGGAAGTCCCAACCGAGAGCAGTT
>probe:Drosophila_2:1624061_at:668:265; Interrogation_Position=302; Antisense; CAGTTGCAGCAATTTCACCAGCGCA
>probe:Drosophila_2:1624061_at:318:129; Interrogation_Position=318; Antisense; ACCAGCGCATTGGAATGGCGGCTTT
>probe:Drosophila_2:1624061_at:621:277; Interrogation_Position=339; Antisense; CTTTGATGGAGGAACTGCGCGGCTT
>probe:Drosophila_2:1624061_at:59:195; Interrogation_Position=351; Antisense; AACTGCGCGGCTTGGGCCAAGGAAT
>probe:Drosophila_2:1624061_at:636:691; Interrogation_Position=362; Antisense; TTGGGCCAAGGAATCCAGGGTCAAC
>probe:Drosophila_2:1624061_at:349:267; Interrogation_Position=377; Antisense; CAGGGTCAACAGTACTAGTGGCAAA
>probe:Drosophila_2:1624061_at:575:645; Interrogation_Position=39; Antisense; TCATCATGCAGATCGTTGCTCTCAC
>probe:Drosophila_2:1624061_at:644:711; Interrogation_Position=425; Antisense; TTCGAATTAAATCCGTCTATGCTTT
>probe:Drosophila_2:1624061_at:681:337; Interrogation_Position=56; Antisense; GCTCTCACCCTCGTTGCGTTTGTGG
>probe:Drosophila_2:1624061_at:704:325; Interrogation_Position=71; Antisense; GCGTTTGTGGCCATTGCCGGTGCCT

Paste this into a BLAST search page for me
GCCGGCGCCTACACAGAACAGGTGCGTAAATCACTTAGTTCATCATGCAGAACAGGTGCCCCACTACGTGGGAAGTGGGAAGTCCCAACCGAGAGCAGTTCAGTTGCAGCAATTTCACCAGCGCAACCAGCGCATTGGAATGGCGGCTTTCTTTGATGGAGGAACTGCGCGGCTTAACTGCGCGGCTTGGGCCAAGGAATTTGGGCCAAGGAATCCAGGGTCAACCAGGGTCAACAGTACTAGTGGCAAATCATCATGCAGATCGTTGCTCTCACTTCGAATTAAATCCGTCTATGCTTTGCTCTCACCCTCGTTGCGTTTGTGGGCGTTTGTGGCCATTGCCGGTGCCT

Full Affymetrix probeset data:

Annotations for 1624061_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720