FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624062_at:

>probe:Drosophila_2:1624062_at:225:21; Interrogation_Position=1422; Antisense; ATATTCTTTGTTTCCTGCCCATTAT
>probe:Drosophila_2:1624062_at:108:67; Interrogation_Position=1445; Antisense; ATGGATGTGTCCTATGCGCTAGAGA
>probe:Drosophila_2:1624062_at:609:35; Interrogation_Position=1526; Antisense; ATCAGGAACGAAGTGCTGGCGCCCT
>probe:Drosophila_2:1624062_at:365:581; Interrogation_Position=1542; Antisense; TGGCGCCCTTGTTACGCGATATAGA
>probe:Drosophila_2:1624062_at:34:451; Interrogation_Position=1559; Antisense; GATATAGAAACCCAAACGCCCGACA
>probe:Drosophila_2:1624062_at:86:563; Interrogation_Position=1598; Antisense; GGAACGATGACCGATGATTTCCCAG
>probe:Drosophila_2:1624062_at:468:415; Interrogation_Position=1631; Antisense; GAGCCTGTTGCGGTCGGAAGCCATT
>probe:Drosophila_2:1624062_at:70:205; Interrogation_Position=1648; Antisense; AAGCCATTTCCACGCGTATTCAGAA
>probe:Drosophila_2:1624062_at:275:195; Interrogation_Position=1672; Antisense; AACTGAACCTATGTTTGACTTGCAA
>probe:Drosophila_2:1624062_at:111:601; Interrogation_Position=1710; Antisense; TGTACACCCAAACTTGCGACGATTT
>probe:Drosophila_2:1624062_at:105:179; Interrogation_Position=1770; Antisense; AAACTCACTGGCCAGATGGTCTGTA
>probe:Drosophila_2:1624062_at:583:65; Interrogation_Position=1785; Antisense; ATGGTCTGTACAACACGCAGCACAC
>probe:Drosophila_2:1624062_at:57:29; Interrogation_Position=1826; Antisense; ATAATGGACGAACTCTTCCCCGACA
>probe:Drosophila_2:1624062_at:18:191; Interrogation_Position=1850; Antisense; AACTTTCAGTCCACTTGCACGCAAA

Paste this into a BLAST search page for me
ATATTCTTTGTTTCCTGCCCATTATATGGATGTGTCCTATGCGCTAGAGAATCAGGAACGAAGTGCTGGCGCCCTTGGCGCCCTTGTTACGCGATATAGAGATATAGAAACCCAAACGCCCGACAGGAACGATGACCGATGATTTCCCAGGAGCCTGTTGCGGTCGGAAGCCATTAAGCCATTTCCACGCGTATTCAGAAAACTGAACCTATGTTTGACTTGCAATGTACACCCAAACTTGCGACGATTTAAACTCACTGGCCAGATGGTCTGTAATGGTCTGTACAACACGCAGCACACATAATGGACGAACTCTTCCCCGACAAACTTTCAGTCCACTTGCACGCAAA

Full Affymetrix probeset data:

Annotations for 1624062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720