Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624064_at:

>probe:Drosophila_2:1624064_at:641:319; Interrogation_Position=1031; Antisense; GCCGCAGGGCCGTTGAGATATCGAT
>probe:Drosophila_2:1624064_at:590:499; Interrogation_Position=500; Antisense; GTCTGCCATGTCTTCAGATACGCGA
>probe:Drosophila_2:1624064_at:229:283; Interrogation_Position=538; Antisense; CTGTTATCAGATTTTCCTACCATTG
>probe:Drosophila_2:1624064_at:223:273; Interrogation_Position=571; Antisense; CTTTTGAAACAGTCGGGCATTGGCA
>probe:Drosophila_2:1624064_at:513:103; Interrogation_Position=629; Antisense; AGACCAAGTCGAATCGCGATCGCGC
>probe:Drosophila_2:1624064_at:478:333; Interrogation_Position=652; Antisense; GCTGGTCGCCTGATTTCCGAATGGG
>probe:Drosophila_2:1624064_at:362:323; Interrogation_Position=674; Antisense; GGGCTCGGCCGATATTCAACGTTAG
>probe:Drosophila_2:1624064_at:400:475; Interrogation_Position=694; Antisense; GTTAGCTGCAACTTCTCAGCGATGA
>probe:Drosophila_2:1624064_at:148:293; Interrogation_Position=741; Antisense; CGATTTGGCGCAGATGTCACGTCAT
>probe:Drosophila_2:1624064_at:338:259; Interrogation_Position=798; Antisense; CAGCAGCAAAGCACCTACCTTAAAT
>probe:Drosophila_2:1624064_at:728:73; Interrogation_Position=839; Antisense; AGGACAAGATGCTGCGTCCCGGAGA
>probe:Drosophila_2:1624064_at:112:435; Interrogation_Position=940; Antisense; GAGGGTGAAGTCTCCGCGTCGACAA
>probe:Drosophila_2:1624064_at:690:199; Interrogation_Position=965; Antisense; AACGCAAGCCAAACCGCTACGAGAA
>probe:Drosophila_2:1624064_at:397:139; Interrogation_Position=999; Antisense; ACGTTTCCTGGACTCAAAGCGACTG

Paste this into a BLAST search page for me
GCCGCAGGGCCGTTGAGATATCGATGTCTGCCATGTCTTCAGATACGCGACTGTTATCAGATTTTCCTACCATTGCTTTTGAAACAGTCGGGCATTGGCAAGACCAAGTCGAATCGCGATCGCGCGCTGGTCGCCTGATTTCCGAATGGGGGGCTCGGCCGATATTCAACGTTAGGTTAGCTGCAACTTCTCAGCGATGACGATTTGGCGCAGATGTCACGTCATCAGCAGCAAAGCACCTACCTTAAATAGGACAAGATGCTGCGTCCCGGAGAGAGGGTGAAGTCTCCGCGTCGACAAAACGCAAGCCAAACCGCTACGAGAAACGTTTCCTGGACTCAAAGCGACTG

Full Affymetrix probeset data:

Annotations for 1624064_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime