FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624065_at:

>probe:Drosophila_2:1624065_at:589:533; Interrogation_Position=1045; Antisense; GGTGCCAGATAACACGATTTCCCGA
>probe:Drosophila_2:1624065_at:157:567; Interrogation_Position=573; Antisense; GGCACCGATCCCGAGGATGTGATCA
>probe:Drosophila_2:1624065_at:545:595; Interrogation_Position=590; Antisense; TGTGATCAAGAACGCCTTCGGCTGC
>probe:Drosophila_2:1624065_at:520:449; Interrogation_Position=648; Antisense; GATCGCCTGAGGGAGCTGCTGACCA
>probe:Drosophila_2:1624065_at:96:129; Interrogation_Position=669; Antisense; ACCACCATGGGTGATCGGTTCACAG
>probe:Drosophila_2:1624065_at:545:439; Interrogation_Position=720; Antisense; GAGGCGCCCATCAAAAACGGTCTGT
>probe:Drosophila_2:1624065_at:393:197; Interrogation_Position=735; Antisense; AACGGTCTGTTCGACTACCTCGAAT
>probe:Drosophila_2:1624065_at:550:245; Interrogation_Position=757; Antisense; AATTCACGCGCATCCTTAAGCACGG
>probe:Drosophila_2:1624065_at:23:57; Interrogation_Position=796; Antisense; ATGAGCAGTAAGATCGCCAGCAGTC
>probe:Drosophila_2:1624065_at:310:115; Interrogation_Position=814; Antisense; AGCAGTCGATTCACTAGCCAGCTGC
>probe:Drosophila_2:1624065_at:669:315; Interrogation_Position=850; Antisense; GCCTGTCCAAACTATCCATCATGAG
>probe:Drosophila_2:1624065_at:341:315; Interrogation_Position=932; Antisense; GCCTTCTGTTCTTTGATTCCTGATA
>probe:Drosophila_2:1624065_at:390:47; Interrogation_Position=957; Antisense; ATCCTGTACTTATCCGTGCATTTGA
>probe:Drosophila_2:1624065_at:536:183; Interrogation_Position=990; Antisense; AAAAGTAGCCAACACCAGCGATTGT

Paste this into a BLAST search page for me
GGTGCCAGATAACACGATTTCCCGAGGCACCGATCCCGAGGATGTGATCATGTGATCAAGAACGCCTTCGGCTGCGATCGCCTGAGGGAGCTGCTGACCAACCACCATGGGTGATCGGTTCACAGGAGGCGCCCATCAAAAACGGTCTGTAACGGTCTGTTCGACTACCTCGAATAATTCACGCGCATCCTTAAGCACGGATGAGCAGTAAGATCGCCAGCAGTCAGCAGTCGATTCACTAGCCAGCTGCGCCTGTCCAAACTATCCATCATGAGGCCTTCTGTTCTTTGATTCCTGATAATCCTGTACTTATCCGTGCATTTGAAAAAGTAGCCAACACCAGCGATTGT

Full Affymetrix probeset data:

Annotations for 1624065_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720