FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624067_at:

>probe:Drosophila_2:1624067_at:403:169; Interrogation_Position=1006; Antisense; AAATGGCTTCCGTTGGCGTTCTCAA
>probe:Drosophila_2:1624067_at:522:483; Interrogation_Position=1073; Antisense; GTATCAGCCGCAACAGGAGTTCGTG
>probe:Drosophila_2:1624067_at:680:297; Interrogation_Position=576; Antisense; CGCTCGCAGCGACGGTTTATCAAAA
>probe:Drosophila_2:1624067_at:609:49; Interrogation_Position=621; Antisense; ATGCCGCCTAGTGTTCTCGAAAAGA
>probe:Drosophila_2:1624067_at:497:547; Interrogation_Position=680; Antisense; GGATGTTGCAGTTTCCTACTACCAT
>probe:Drosophila_2:1624067_at:597:673; Interrogation_Position=699; Antisense; TACCATTTGAACAGACTCTTCCGCA
>probe:Drosophila_2:1624067_at:678:297; Interrogation_Position=720; Antisense; CGCACCCAAGGATACGTCGGAGATT
>probe:Drosophila_2:1624067_at:426:571; Interrogation_Position=787; Antisense; GGCTGCCCTATTACAGTCACGTTAA
>probe:Drosophila_2:1624067_at:218:553; Interrogation_Position=821; Antisense; GGAGCATGCCCATTTGTCCAATGTA
>probe:Drosophila_2:1624067_at:264:231; Interrogation_Position=840; Antisense; AATGTACTCTTTCTGCGCTACGAAG
>probe:Drosophila_2:1624067_at:508:573; Interrogation_Position=872; Antisense; GGCTGATCTGCCAGGTGCAATCAAC
>probe:Drosophila_2:1624067_at:565:27; Interrogation_Position=900; Antisense; ATAGCCAGCTTCTTAGAGTGTCCAC
>probe:Drosophila_2:1624067_at:717:457; Interrogation_Position=942; Antisense; GATAGGCTACTCGATCATCTGAGCA
>probe:Drosophila_2:1624067_at:672:375; Interrogation_Position=970; Antisense; GAAGCTTCCGTGAGAACAAGTCCGT

Paste this into a BLAST search page for me
AAATGGCTTCCGTTGGCGTTCTCAAGTATCAGCCGCAACAGGAGTTCGTGCGCTCGCAGCGACGGTTTATCAAAAATGCCGCCTAGTGTTCTCGAAAAGAGGATGTTGCAGTTTCCTACTACCATTACCATTTGAACAGACTCTTCCGCACGCACCCAAGGATACGTCGGAGATTGGCTGCCCTATTACAGTCACGTTAAGGAGCATGCCCATTTGTCCAATGTAAATGTACTCTTTCTGCGCTACGAAGGGCTGATCTGCCAGGTGCAATCAACATAGCCAGCTTCTTAGAGTGTCCACGATAGGCTACTCGATCATCTGAGCAGAAGCTTCCGTGAGAACAAGTCCGT

Full Affymetrix probeset data:

Annotations for 1624067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720