FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624069_at:

>probe:Drosophila_2:1624069_at:141:135; Interrogation_Position=127; Antisense; ACGCCAACGCGAATGCTAATGCCAA
>probe:Drosophila_2:1624069_at:357:49; Interrogation_Position=145; Antisense; ATGCCAATGCCCAGGGCGGCCTTGG
>probe:Drosophila_2:1624069_at:25:289; Interrogation_Position=161; Antisense; CGGCCTTGGAGGTCGTCCTGGATTC
>probe:Drosophila_2:1624069_at:291:563; Interrogation_Position=37; Antisense; GGAAGCAACAACTCAACATGAAACT
>probe:Drosophila_2:1624069_at:630:11; Interrogation_Position=392; Antisense; ATTCGGTGGTGGACGTCCTGCAGTC
>probe:Drosophila_2:1624069_at:81:645; Interrogation_Position=441; Antisense; TCTTCCTCGGCATCGGCTAGTGGTG
>probe:Drosophila_2:1624069_at:172:139; Interrogation_Position=470; Antisense; ACGTGGTGGCGCTGGATCCGCTTCT
>probe:Drosophila_2:1624069_at:543:343; Interrogation_Position=489; Antisense; GCTTCTGCATCGTCATCCGCCAATG
>probe:Drosophila_2:1624069_at:337:249; Interrogation_Position=509; Antisense; CAATGCCTCCGGAGGTGGACTGTAC
>probe:Drosophila_2:1624069_at:634:551; Interrogation_Position=525; Antisense; GGACTGTACGGTTAGACCGATCCAA
>probe:Drosophila_2:1624069_at:253:413; Interrogation_Position=539; Antisense; GACCGATCCAAACTATACTGGTATT
>probe:Drosophila_2:1624069_at:583:55; Interrogation_Position=54; Antisense; ATGAAACTTTTCATCGCGCTCTCTG
>probe:Drosophila_2:1624069_at:528:281; Interrogation_Position=72; Antisense; CTCTCTGTTCTGGTGGCTGTGGCAT
>probe:Drosophila_2:1624069_at:337:577; Interrogation_Position=98; Antisense; GGCCCTGCCTCAATTCGGCGGAAAC

Paste this into a BLAST search page for me
ACGCCAACGCGAATGCTAATGCCAAATGCCAATGCCCAGGGCGGCCTTGGCGGCCTTGGAGGTCGTCCTGGATTCGGAAGCAACAACTCAACATGAAACTATTCGGTGGTGGACGTCCTGCAGTCTCTTCCTCGGCATCGGCTAGTGGTGACGTGGTGGCGCTGGATCCGCTTCTGCTTCTGCATCGTCATCCGCCAATGCAATGCCTCCGGAGGTGGACTGTACGGACTGTACGGTTAGACCGATCCAAGACCGATCCAAACTATACTGGTATTATGAAACTTTTCATCGCGCTCTCTGCTCTCTGTTCTGGTGGCTGTGGCATGGCCCTGCCTCAATTCGGCGGAAAC

Full Affymetrix probeset data:

Annotations for 1624069_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720