FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624070_at:

>probe:Drosophila_2:1624070_at:525:649; Interrogation_Position=474; Antisense; TCAGCGTCACATTCGGTAAATATCG
>probe:Drosophila_2:1624070_at:497:1; Interrogation_Position=484; Antisense; ATTCGGTAAATATCGCTTGGACAGG
>probe:Drosophila_2:1624070_at:592:343; Interrogation_Position=498; Antisense; GCTTGGACAGGCGACAACATCGTCG
>probe:Drosophila_2:1624070_at:499:503; Interrogation_Position=519; Antisense; GTCGCCAGGCTCTCTCAGATATAAA
>probe:Drosophila_2:1624070_at:400:459; Interrogation_Position=536; Antisense; GATATAAACTCTGTTCTGTTCAGTA
>probe:Drosophila_2:1624070_at:624:471; Interrogation_Position=548; Antisense; GTTCTGTTCAGTAAGACCACTTGGG
>probe:Drosophila_2:1624070_at:462:125; Interrogation_Position=563; Antisense; ACCACTTGGGAGTCGAACAGGCGCC
>probe:Drosophila_2:1624070_at:466:385; Interrogation_Position=577; Antisense; GAACAGGCGCCAATGCTTGTACCGA
>probe:Drosophila_2:1624070_at:666:723; Interrogation_Position=593; Antisense; TTGTACCGACTCTCAACGTCTGTAG
>probe:Drosophila_2:1624070_at:463:405; Interrogation_Position=600; Antisense; GACTCTCAACGTCTGTAGATTGCGC
>probe:Drosophila_2:1624070_at:124:679; Interrogation_Position=615; Antisense; TAGATTGCGCATGTGACTCCGTTCA
>probe:Drosophila_2:1624070_at:147:405; Interrogation_Position=629; Antisense; GACTCCGTTCACACCAATCGAAAAT
>probe:Drosophila_2:1624070_at:624:387; Interrogation_Position=648; Antisense; GAAAATGCAAAATGCCCGCCTAGCT
>probe:Drosophila_2:1624070_at:564:165; Interrogation_Position=657; Antisense; AAATGCCCGCCTAGCTGTCCGCAAG

Paste this into a BLAST search page for me
TCAGCGTCACATTCGGTAAATATCGATTCGGTAAATATCGCTTGGACAGGGCTTGGACAGGCGACAACATCGTCGGTCGCCAGGCTCTCTCAGATATAAAGATATAAACTCTGTTCTGTTCAGTAGTTCTGTTCAGTAAGACCACTTGGGACCACTTGGGAGTCGAACAGGCGCCGAACAGGCGCCAATGCTTGTACCGATTGTACCGACTCTCAACGTCTGTAGGACTCTCAACGTCTGTAGATTGCGCTAGATTGCGCATGTGACTCCGTTCAGACTCCGTTCACACCAATCGAAAATGAAAATGCAAAATGCCCGCCTAGCTAAATGCCCGCCTAGCTGTCCGCAAG

Full Affymetrix probeset data:

Annotations for 1624070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720