FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624071_at:

>probe:Drosophila_2:1624071_at:41:271; Interrogation_Position=294; Antisense; CATCAACCAGTTCGGAGACTCCAAG
>probe:Drosophila_2:1624071_at:510:213; Interrogation_Position=320; Antisense; AAGAGAAACTAATCCCCGAGAGCAA
>probe:Drosophila_2:1624071_at:176:537; Interrogation_Position=388; Antisense; GGTCTATGGTTTCGCCTTCTATATG
>probe:Drosophila_2:1624071_at:96:715; Interrogation_Position=404; Antisense; TTCTATATGCTGTTCACGGTCCTCT
>probe:Drosophila_2:1624071_at:7:483; Interrogation_Position=434; Antisense; GTATACGTGACTTGGGCGCTGCTGC
>probe:Drosophila_2:1624071_at:135:337; Interrogation_Position=454; Antisense; GCTGCCAGTGGAGTTTGGTCTGCAC
>probe:Drosophila_2:1624071_at:280:353; Interrogation_Position=475; Antisense; GCACTCGTATCTGCCGGACAAGTAT
>probe:Drosophila_2:1624071_at:600:15; Interrogation_Position=498; Antisense; ATTTTGCCGTATTTGTGCCTTTTCT
>probe:Drosophila_2:1624071_at:430:547; Interrogation_Position=589; Antisense; GGATGTTGATTCCATTGCCTCGGTG
>probe:Drosophila_2:1624071_at:138:593; Interrogation_Position=612; Antisense; TGGTGGATCCAAAGCTGGCACTGCC
>probe:Drosophila_2:1624071_at:205:131; Interrogation_Position=653; Antisense; ACCTCCTGGTCGCAGTTGCAAAAAG
>probe:Drosophila_2:1624071_at:183:79; Interrogation_Position=681; Antisense; AGGTCAGCCAGGATTCCGCATCAAA
>probe:Drosophila_2:1624071_at:596:167; Interrogation_Position=703; Antisense; AAAGAAGGCCTCTCCAGTGAACTGC
>probe:Drosophila_2:1624071_at:446:687; Interrogation_Position=769; Antisense; TATTCCACCACTGCGTTTTCTGGAC

Paste this into a BLAST search page for me
CATCAACCAGTTCGGAGACTCCAAGAAGAGAAACTAATCCCCGAGAGCAAGGTCTATGGTTTCGCCTTCTATATGTTCTATATGCTGTTCACGGTCCTCTGTATACGTGACTTGGGCGCTGCTGCGCTGCCAGTGGAGTTTGGTCTGCACGCACTCGTATCTGCCGGACAAGTATATTTTGCCGTATTTGTGCCTTTTCTGGATGTTGATTCCATTGCCTCGGTGTGGTGGATCCAAAGCTGGCACTGCCACCTCCTGGTCGCAGTTGCAAAAAGAGGTCAGCCAGGATTCCGCATCAAAAAAGAAGGCCTCTCCAGTGAACTGCTATTCCACCACTGCGTTTTCTGGAC

Full Affymetrix probeset data:

Annotations for 1624071_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720